Description :
From Genome Similarity Track
Location :
scaffold_853:3111- 4645
Transcript NameFunction/comments
g10453.t1hypothetical protein

Sequence
1534 bases(100 bases per row)
GTCCGGTGACCAGACTGAGTGTATTTGTTCTTCAGAGTTGTGCACACTCTGAAGTACACTTCTGGTCTGTTGGGCCCCTTTGCGGTCAGGCGAAGGTTCT
TCCACAATCTTCCACAGATGTCACACGGGTGCAGCCGCGTCCCAAGCCCCCCTCCCCCAAAACCCATATTATAACCAATCACAGTGTAGCGTAACGGCGA
CCTGTCGCTCGAAAATCGGAAATAGCATCATGTCAACCGCCCCTCCTGGTCACGATCCCTCAGTGCGGAACTTTCTCCAAACTGTGAATCATGGCCAGGT
CTTTCAGACACTCCGATGGCCGGTTTTCAGAGCGTAGTGTAGCGGCAACACTTTGCCAGTTGCCAGGATTTCAGAGTCTCTGGCGCCCTGTCGCTCAATC
TGATTCCTCCCTCAGACTCAGAAATTCACACTTGGCTCGCCCAACGTGCGGTCATATCCCAATCCACTTTCTCACGCACATGTCGGAGGAAGCTGACACG
TCCTTGGGCGCATGCACCCCCACGAACCCCTCGGCAGGCGACGCCACGGGCATGAGTCCCGCTTAACGCGACCCAGAGTGGCGATGGCGGCACTTCCGCT
TTGCAAGGTGGCAGCTCAAGCACCCCAGCTCTGGTGTCAGAGTTGCGGACTGCTCCGGCGAGCGCTAACGCCGACAGTTCTCCTGGAGTTGCGGTCACCA
CGGACGGCCGGACTGAGCAAGTGGCTCTACGTCTGCTGCGTCTCCCGCACCTGGTCTGGCAACGTCTGGTGTCACGGCATCTTGCGGTAGGTCACTCTCA
TTCGGCGCCTCAAGGTTGCTGTCGACCGCCGAGGTTGACAGGCTCTTTCACCGGGGTCTGGTGACGGACAACGGCGAACACGTCACGGACCTGGGCGACT
CTGAAGTCCCTCCAAAGTGGATCGTGCCATCCACAGAACCGGAAGGTCGAGTCTTTCTGGTGGGCGTCCCTGCTCGCACTGAGGATTTCCGTGAAGGTCG
ACATGTGGCGAACACGTATGATGGGCCCTGCGTCCTGGTGGGCTACGAAGACTTTACGGGTGAGGATATCAGCGAGCTGGAGCGCGTGATCCCAAGCTTC
TTTCCAAGCCAGGTGGTGTTACCACATGCAGCAACCCCGAATGCTCGAGAAATGGATGCTTTGGCGGCCTCTATTGAAGTCCGCAAGGAGACCACATCGA
CCTTGTCGCGTGCCCCCCACTCCCGCCTTGCTGAGCGCGTATTCAAGACTGCAGAATACCTGAAGCGCATGGCTACCGCCCACCGTCGTCTTCGGGAGCG
CGTTGGTTCCCAGAGTGGCGTTGCTCTGATTGATACAGCGGCGGCGCGCACCGAATGCGAGGAGCTCAAGCGCGAATGGGTGCTGAACTGCCAGTACTGG
CGCCACGAACTCCTGAGTGCACAGCGAGAGGCCGGTGTGGTCGAGGACCGTATGACTTCAGAGATCCAGAGTCTCACGTCACATTACTAGGATCAAGTGG
AAGCCCTGAAGGCTGAGAAGGCGGCTCTGAAGTC