Description :
From Genome Similarity Track
Location :
Scaffold_82:31108- 32491
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18268hypothetical protein

Sequence
1383 bases(100 bases per row)
GACCTTTGCCCGTCTCGCAATCCACACATTCACCGACATAGCGTTGCACGCTCTTGTGCAGTCCTCTCCAGTGGAACCTATCCCGGATCCGCTGATAAGT
ACGGCCAATACATTGATGCCCACCCTCCAAGCTGAGATGGTAGTGATGTAGGATATCTTGATGTAGAGCCTCCGGCATTCTCAATCTCATCAATCCGTCG
CGGTCTTCATCACTACGCTTAGTAGGAGGATAATAGAATAGTAGATCGTTTAGATCCACTTTGTAATATGTGGTGACGGGACTAAACGATTTGGCCACTT
CTCGACTTAGATCGGACACATCTCCAATCAGGTATTTCTTCAAGCTCGAGATCCACGCCTCCTCACCTTGCGCCTTCTCGATCCAATCTATACGGAGTCC
TCTCACATATTGTTCTTACAGGATCTGGAGTGTAGACGCCGTCCTAGCTCTTGATTGGAAAGTTACAGCGGATATCTGCGAGGCTTAGACTTCAGATCGC
GCCACGAAACCCTCCTCCAACCGGTTCACTGTAATGGTATCTTGATAGTCGAATTCTACCTCTACCTCAATCTTGCATTGTTTCTGCAATGCCGAACTCG
CTAGGCTGTCTGCACTGGCGTTCCAATCACGCTTGACATGCACCAAGTCATCACCTATCCACTGTCGTATCCGATTCAGTACTCATTGCATTAGCATCGT
CAATCCGGATACCTTACAGTCGATCTCAACTCGTACCTGCCGGGCCATCAGATTGGAATCACCACAGATCACCAATTGCTTCTGATCGGCCTCACTCAGC
TGACCCAGACCCAACAGCAGCCCATGATATTCCGCTTCGTTGACTGTAAGTCCCTCACCGTACGCGGATCTGGCTTTCAATACCTTCACTCGGGTAATTT
CCACAAAGTCGCACGGTAGGCACCTCCCCCATTATTCACATGAGCAGGTCCTCGTCAGGTTGTACCGTCGGGATCACAGTCCGGATCTATCGGCTGGGCC
CTTTTCTGGGCGTGATCCGGGTGAGCACCTCGTCTACCTTTGACCGGGCGTGATTCTTGCTGCATGAACTCCCAAGATCTCGTCTTCTCCCTGTAAATAC
TCCGCGATCTCCAAAGTTCATGACGAGAGCAGAGCAGTCCACTGGCCAAGGCACCCATGGAGGCCGGTTGATTTGAAAAGCCAACCTGTAGTGCTGGGTC
AGCGTCCGGATAGATCGCCCCACGAGCAGATTGCAGGACTCGCAGAAGTACAAGAATCTTGTCTCTATGACACCATAGTTGAGCTGATTAGATTCGAGCG
TTCGACTTTGTCAAAGTGTCTCGATGATAGGTCCCGTCGTGTTCCTGTACCAGAATAGCCGAGCCGGCCCAATCGCTGGTTTA