Description :
From Genome Similarity Track
Location :
Scaffold_39:311014- 313162
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011971Similar to B11B22.010: E3 ubiquitin-protein ligase TOM1-like (Neurospora crassa)

Sequence
2148 bases(100 bases per row)
TCATGCCGTCGTGAAGCCATACAAATCCGTCTCCAGCGTCGCATAGAGCACGGTCTTGAACTCCAGCTTAGAGCGATACAGCGGCAGCTCCAAGCGGTTG
AAGCACGCGTGACTGGAAATGTACTGCGTCGAATAATACGACACGCCCTTGAGCGTAAACGGGCACAGGCGGCCATCGTAACTGGTCAGACCAGCGAACC
CAGCGAGCGGTACGCGGGACGACCCCGTCGCGAACAGCAGCAAGCGGCGGCGATACTCGTTCGGCATGTCGCCGACGACTTCCCAGAACCAGCGCAGCAC
GCTCGAGCCGTTCAGATTCACCGAGTTGACCGTGTTCGCCTGCCAATCGGCGACGTCGATCTCCTGCGTGCCGCAGAGCAGGTAGTCAAACTCCTCGGCG
TCGAAGATCATGAGCAGATCCTGCGGGATCACTTCGTACAGACCCTTGAGGAACATGTACAGCTGACTCGACACACTCTCAAAGAGCATATACTGGAACT
TGCGCTCAAGGTACTGGTGCTTGTTGGCGTCCGTGACCATGATGTTGCGGCCGTCGGGGATCAAGTCCACAGTCACGACGTCGGCGCCATGTTGCTCGGT
CACGCTAAAGTCCAGACCGAGCGTCTCGACGCCATCGTTCTCGAGCAGCCACTGCATGCTCTTGTACGCCTCGGGGTCAAAGTACTCCAAGTCGCTGAAC
GACACGGGGATGCCCAGGACGGTCTTGACCAGCGGCATGGACAGATGGAAGCCCCAGACGCCGCCTTCGAGCAGCGCGCGGCCGATGAGTCGCCCCGTCG
AGAAGTAGTACGTCAGGTGGTCGTCGCCAATGTCGTGCGCCGAGTTCGGGTTCAGGTAGAACGACTGATCGCTCTTGTTGTGGCACACAAACAATTGCAA
TTGCGGGCTCAGCAGCATCTCGTTCACGAGCATGAACCACTCGCGATGCACGCCGCCGGCGTCCACGCCGCTCTCGTCCAAGAACGTGATGCGCATGAAC
GAGCGGATGTTCTTCTCCTGGATGCAGCTCAAGTGGTCGATCGACTCCTCCAGCATGTACTCGCGGTGCACTGAGAGCTTGAGAAACTCGACTTCTGCTG
GCACGATCAGCGACGCCGTACTAATCACGAAATGCGCGTACTTGGTTGGGAAATCCTGCGCCATGAACGTCACGACCTCGTTCATGCGCTCCTTGGACTC
GAGCGTGCTACCCGTCGGGAAAACCGCCGGGTTCGCGTCGTTCGACGGAACGAGGTCCATCGTGATGCTGTCGTCCCATTTCACGATCCCCGCAGCCGCG
ACGGTCTCGACCTGGTGCTGCGACTGCTGCTGCTGCTCAGCAAAGTCGTCCTCTTGCTTTTGTTGCTGGAACCGCACGGCGAACCCGAGAAACTGCGACT
CGACGGCGCCACCGTTCACGCACCCGCGGTACCAAAACATGTTGCCGTCCACATCCAGCTTGCGCACCCACTCCTTGCGTTTCCTATAGAAACCCAAGAG
GATTTGGTGAATGCGCCATTCCCATCACCAAATACGTAAACTATACGCCAGAAAAGAACGCACCGCGCGCGGATTTGCTGCGTCGTGAGCTGCTGCACGC
CGTTCGTGGGCGTCGCGCCGTTGTCGCTCTCCGACTTCTTCTTCTTGACCGCGTCGTCCGCATTGTCGACCGCGAGCTTTTCGCCGCAGAGACTGCAGTA
CGCGAAGCGCTTGAAATTCTCAAACTCGCAGCTTGGACACACCGTGAACCCTGCCTCCGCTTCTCTGTAATAACAGACAGGAGAATAGTTTTAGCACCGC
AGGCTTTCGTACAAGCGTGCGTGTGCGTATATAATAAATGAGGGCGACGTACCTGGTCGCGGCGTCAATGCGATGCTCCACCGATTCGCCTCTGCAATAT
ATAAAGAACCGCACACGTTGAGAGCGTTAGCATATTAAAATGCAAAGTGTATATACATGCCTCCAGACACATTTTATATACAATATATACACGTACGAGA
GCAGCGGCGTGTGCATGTTTTCGAGCATGCGGTGATGCCGCTTGCGGCACCCGGCGAGCCAGACGATGAGGAAGATGACGCAGATGACGAGCATGCCCAC
GCCCTGGTAGAGCATCGCTGACACCGTGTTGTCGCTCGAGCCCGCCAT