Description :
From Genome Similarity Track
Location :
Scaffold_1202:3110- 4771
Sequence
1661 bases(100 bases per row)
AAGGGTGTGCGCGCGGGCGCTGGCGTTCGCGGAGGTGCGGAGGCACGCAGTGCAGCAGCACGAGAGGAGCGAGGCTCCGAGGCGGATCTCGCGAGAGGCT
GTCTGCGGTCGAAAGACCAAAAGGCTTTATCACTTGAAGTCATGTGAGGGCGCGTTGCGCCGAGAAGTTCTCAGAGAAGTCCACGCGAATGTGGATTGAC
TCGTTCGAGAAGGAAGCTTGACGGAACAAGACCCGGAGGTTGACCGTTAAGCGTGAACACCCGTGTCCACGGTTTGGTGGGGGAGGGTGTAACGGGGTTA
CACGAGAGTTTCCCTAAGGGATATGAAGTGGGTACACACTGTCTAACCTAAATCAGTAGGAGAATCAGTACATGGCTTCAGATCCACTGATTATGCATAT
GACTAGGGTTCACTTTCTAGCATAGTGAACCGGATACATTTACACCGTAGGCGGCTTTGCCGCAATAAAGGGAAATACATTCAGTTTGAGATTCACACAG
TTAAGAGTTAAGAGTTGACTCTTTGAGTCCGTAAGGTGTACGGACTCGTACGTTCTGGTATTAGAACGGGCTATCTTAAGCTGAGACTCTGTGAGCCTGT
TAAGCTTCCTCTGACGCAAAGCTACGGCAGCCCCGCCGCATTCTTCATCTTCACGTACTTCACCCAAGTGTCCATCGCAGGTATCCACAAAGAAATATGC
CCGAACTCGTTAAGGTTCAAAGCCCGAAGCAAGGCGTCTGGAGTTTTTCTCTGGCTCAACCAGTTCTTCGTCAAACCTTCCTCTAGCTTGGCAGCAATGT
TCTCAGTGCTCGGTACGTTTTTCACCTCCACGATCATCTTTGCCAGTGCTTCATCGCCGTATTGAGATGCCAAGGTGGAAGCCATCGACCTTCCAGCCGC
TTCGGAATTCTTCTTGTATCCTTTTGTAACTGCGGTGGTCCACTTCTGGAACTGCGGATTTTCAAGAAGCTTCGTGTGTTGATAGGGGAACTTCATTTTG
GTGAAGAGTTGAAGCACTTCATCACCCCTTGGACGAGACTTTGGGCGGAGAGACGGTTTTATCGATATACCGTCTCCCCTCCCAGGAGGAGTCGGTATTC
CCGGTATTACCGTCTCCCCCTTGAAAAGTGTTTGGAAAAGGAGACGAAACTTCCGTCTCTCCTCGTCGTCGACTGCTGCGTACTTTACGCGCTGGTCAGA
GTCTCACTGGCTCCTTCTGCGATTGGTCAAAGCGATGCCTAAGCCTGAGGCGTACTTTGCCTTTCAGCAGGCCTTTTGACAGGCCTGGCTGCAATATTTT
GCGATCTTTCCGCGAAGTTCCTACAGAATACACTAAAACGCTGGTTCTCTATTATAGGATAGATTATGGGCCAATGGCTCTCTCGAAACGGGAGACGCAG
TACACTATCGTATCTTCTAAGTGCGTCTCCGCGGGAGTTTCGGGGAGACGTTAAACCTCGGGAGACGGTCTCTCGAGGTTTTACGTCTCCCGTCTCGTGG
GGAGAGATCGTCTCCCCCGCGTCTCGTCCGAGGGGTGCACTTCATCCTCCGTCTTTGGTTTCTTCGACACTTTTTTGGCAAGCTTCAAGATGACGGGAAT
GTCGACGTTAAAGGCCCTGGCTTCATATTCCCTCGATTTCTTGTGAGTCCTCAGGTGCCGA