Description :
From Genome Similarity Track
Location :
Scaffold_988:3110- 4651
Sequence
1541 bases(100 bases per row)
GCGTCTTTGAATTGTGTAACTTTTAGCTGATTATCGCGGGATATGTTTACCCTGGTCCTCATTAAAAAGCCGCAAGAATCATACACTCTAGCACGGTAGT
CTTAGATTGGAATCTTGCTCCACCACCCCACTACTTGTACGTCAATCCACTAACATCCAACCTCACTCTCCGAAATGGAACGCTTCGAGGCTTCAACGCC
TTCTGGTAGCCCAAGTAGCAGCGATGCAGATGAGGAAATGCTGGTCAAGTAGACCCGACATGCCGTGGGCATGATGGAAGTCGCCAATCCTCCCTCTTAG
CGACAACCCGTCGCCTTCAATGATTCATCACCTTCACTTTCAGGTGCGGGGTTTTTCGTTTCTCTTTCGACCAACGCTGTTACTGTAACACCGACGCCAC
CAGCTCTCCCGGCGAACTCAAGTTCGGTACACGGTTGACACGACCGGGACACTACATTGGACTTTGTGATTTCTTAGTTAGACATCCAATCTGGGAGTTC
TATGACGACACCTCTAAGGTTAGGGTCATCCTAATCCCTGCTTCCGCAAATGAGTCGTCCCAGTAGTTCCTGCGAGGCGCTTCTCTACGAAAGCCACAGA
CCATCTGCCGTATTAGAGCCCAATGAAACAAGCATCCTCGCCCGTTTCAATGTTTTTCACACAATTGGATACGACCCAAAATGAACTTGTTCAGCCTTGC
GAACGTATTCGTGTTTTTTACCGGTTCGTTTAATATTTATTCCAGGGGTGACTTCAGAACCCCGACTTGCAGATCTTTCTCTATGTTATCTTATTTGAAT
GACTCGCCTCTCTTTCTCGTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCCGTCATTCCGTACGCACCTCGAGGGTAACGCAAATCCGGACTTTCC
GTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCCAATACTATAATTCGAGCCCTCTCATTGGCTATTTAGTGGAGCCTCTGCG
CGAGTGGCTATTATAATGCGTAGAGTGGACTACATCACATCGGAACTAGCCGAATAAAATCACTGCTGATTGGACAAAATAAACCGCCTTTCAACAACGT
TTCTTTTCATTTCCATTTTCAAAACGACGCTCCGACGACGGACCAGCTCGACGGAGGACCGGGCGCGATAGCTTCGCAGGCAGGTCATCCCCGCCGCAGG
CAGGGTAGGTATAGATTAATGCTATTTAATTCTAATACATAACGATTTCGGGAGTGCCGCCTGTTGCGGATAACTGGTACCTTCAGGGCAATCGAGGGGT
AACCGTGCGTGTTAGAGGAGGATAACCGGAGCCGTGCATTGTGTGGGAAGGGCACAACTGCACGGAGGGATGGGTACCCTATGACGGCCACACTGATGCG
GCCTAGCCAGCCCCCAAGAGGATCCCATCCCTGCCCAGCGAGCCAGGCCGACCTCTCTCGAAGCAATCGTGACGGTTACCCCGTATTTTCGGGCTTTCTG
GTGAACATGCTATTTTGGGGGGCTCCCTTCACCCCCGGGAA