Description :
From Genome Similarity Track
Location :
Scaffold_1412:3110- 4605
Transcript NameFunction/comments
Phyta_totarag12917hypothetical protein PHYSODRAFT_495899

Sequence
1495 bases(100 bases per row)
CCATGATTGAGATTGGCGCCCAATGTCGTCTTATAGGCGAACGACGGCAGCTCTTTCACTGAGATCGTGCCATCctgaatgcagcagcacacaacgATAC
ATGATGAGTTTTAAATGTTTAACGAGGTCAAATACTAATATCACACGAGTAAAACTTACCGCCATGCCAATTAGAAGAATCGGAGCTTGCGCGGTATCCT
GCGTGCCGCAAAGTGCGGTGACCTGCGAGTCCTGCGTCTCTTTgaaaagctgctggaacggtGGCGTGAGACCCCACACAATAATCTCGGAATCCAAGCC
GCCACTAATGAGGAACGTCTCGTTATTGTTCACCCAGAACTCGAGGTCCATGACGGCGTCGGTGTGGCCATTTTCCTCGGCCGAGAGCACCTTTACGCAC
TGGTACGTAGCCAAGTCCCAGAGCCGAATCGTCGAGTCCACACTCGCCGACGCTAAGATGGGTACACCGCCCACTGAGAAAGTCTTGAGTCTCGTAACTC
CACGCACATGTCCCTGCATCACACCGAGACACTTGAACTGGTTGGTAGCTGTGTCCATCTGCCAGTACCGAATGCACCCATCGGCGCTGCCACTGAACAA
CGTGGCATTGCCCGTCCTGTCCGTCGCCACCGCCAACGCCTGCACATTCATCGTGTGTGCAAAGGGCATCAACTCCGACGCCGGGAACTCGAACGGCGGG
GCCTGTGCGTTCTCGAGATTCCACCCTCTCACCATCCCGACTGACACCTTGGGGTTGGGAGGGAAGCGGCCTTCAAAGCCTGCGAACAGGAAGGGGCCGC
AGAGCACGAGAGCCACGACGCCCTCCGTGTGAGGCGTTTTGTCTCTGTTGCCCcctctgcctcctcctccattgccgttgccgccattggcagcagatgg
aggcAGCGCGTCCTGCACGCTGATGGTGGTGAGCTCCTGCCAGGTGGCGCAGTCCCAGAGCTTGATGCTGGCGTCCGCCGAGCAcgtgaagagctgctgc
ctctcgGCCCACATGACCACGTCCTTGATCGCTCCGTTGTGGCCGCGCGTCTCCCCGATGGTCTTGACGAAATGCGGGTAGCGGCACGGCCGACCGCCCG
ACGTCTGCTCGAACTCGCACTTGCCGCCGTCCATAAAGCGTCTGCACACCTCGTTGCCCACGGACGAGCCCCCGCCGTAGCCCCCGCGGCCGCCACCGTA
TCCTCCCCGTCCACCGCGGTTGCCGCGCCCGCGACTGCGCCCACCGAAGCCTCCTCGCCGGTTGTTGTAGCTCATGCTGATTGACACTCACTGCCTGCCT
AGTGTTGATAATGCGTGGCCGCAGCTATAAAGAGTGAGTGCGCTGGAGACAAACGGGTGGGTTGTGAGGTGTACATAATTTAAACCCGACCCATATTGAC
TACTTGGGATTATTCCAAGATGGGTCGGTCTCCAAAACTCTGTAAGTATACCGTAATAGATTTGACAGGTACCGGAGACGACACTGGCGCAACTT