Description :
From Genome Similarity Track
Location :
scaffold_644:311- 6385
Transcript NameFunction/comments
g9657.t1 putative polyprotein
g9658.t1 putative polyprotein
g9659.t1hypothetical protein
g9660.t1hypothetical protein

Sequence
6074 bases(100 bases per row)
CGAGAAGTGTAACGGGGTGTCCCCCGTTGCATTTCTAGGTATTACTTTTAGTTTCATTTACATTTCTAGGTACATTTTAGACACGTGTTAGGAGTAGCCG
ACACGTGTCACACTAGTAGATAGTGATTGGTCATAATTAGGGTCGCAGACCTATTATGGCCAATCAGCGATCAACACTCAAATTGAGTTGTCCAAAAAGC
TCGGGGCGGGGGCCCCGGGCCACATGAATAAACAGAGTTTAATTTGCTTCCTTTCGGCAAGGTGTAAGACAGTAATTGGCTCTTAGGCCCGTTACACTGG
TAGCACTTCGTAGTCAATCCAACACCAAGATGGAAGGGCCCTTCGAGCAAGTGAGCTTCCCTCACCTCACCGACTTCGAGTGGGAAGCGCTCGAGCGTCT
CTCGACTGTCTCTGGACAGTCTTTCGTCGTGACGCTGCTGCGATCAGCGTCTCCTGATGAACAACGGACGGCCAATCACGAGTTTCTGACGCGCGAGCAC
GCTACGGCCACACAGCGTGCTTCGGCTCCCGCGCGTCCCGACAAGAAGGAAATTGTCAAGATCGACACGTCGCAGTACAGCGGAGTCGGCCAAGACCGAC
TCCCGTTGAACCGCTGGTTCCGCGAGATCGCCATCGCGATGGACGCGAGGCAACTCGCGTCGGACTCCGCACGTGTCCATTTCCTCCTGTCTCGCCTATC
CGGCAAGGCCAAGGAATGAGCCCTCGGCAAGCTGGTTGTCGATGACGACGCCTTCCCGTCTCTTGCAAACCTCGAGAAGGACCTGCGGCTCGCCTTCGAG
CCGCCACAAGACGAGTCGCGCATGCGCGCGGCATTCTTCGCTCTCAAGCAAGGCAAGACATCTATGCGCGACTATGTACAAAAGGCGCGACGCCTTGTGT
CGTGCATCGCTGTGAACCCGATCGACATGGCCACGCAAGTTCATGTATTCATCTTTGGCATGCGTGAGGGCATGACGCGCTACTGTCTTGTTCGTGCCGA
GCCGAAGACTCTCGAACAAGCCTTCGCCCTCGCACTCCGCGAGGACTACACGGTAGCGTTGTCATATGCGAAGCCCATGTCTGCTGAAGCTCGGGTCAGC
GCACCCGAGCCGATGGAGATTGACGCGGTTGAGGCGTCCGCGTCTGACAAGCCCCGAGGCTTTCAGAGCTTCCGCGGTGGTCGTGGAGGCCGCGGAGGTC
GCGGCCAAGGCCCACTGACCTGCTTCCGTTGTCAGAAGCAAGGACATCGCGCGGCGGTCTGTCGCGCACCAGCTCCTGTGCTCGCGAACATCGAGGCGGC
AGACATGTCCGGGGCGTCAAAAAACGGCGAAGACCAGTAGGAGCGGGGCTTCCTACTGGCATGAGTAGAGATCTGGGCACGGTGGCAGCCCGATCTCCTG
ACGCCCCTGTGCTTCATGCACGATTCAATGCCACCACCTCCAGCGGCGATTCGTGACTGATCATTGTCAGTCTCCACGTTGCTGGTGCGCGCCGTCCGCT
CTGCGCGCTTCTCGACTCCGGCGCGACGAACAACTTTCTTCGCGCCTCCTGTTTGCCAGAACTCCCCGCGAACCTCCGTGTTCGCGAGGGTCCGGGCAAC
ATGGTGGTGAAGCTAGCGGACGGCAAGCCGCGGACTGTTCCGCGGCGCTCTGTTTCGCTGTCGTATGAGTTCGACGGCTTCTGCAGCTTAGACGAGTTCT
TGGTGATCGAGATGAGCTACGCCTTCGACTGCATCTTGGGAATGCCCTGGCTGGTGCGCTACCAACCTGAGGTTGACTGGCTGAGCCGGTCTGTGAGATG
TCGTAGCGGCTACGACGTCAGTGAAGTGTACACCCATCTTCTGGTTTCGCCCCGAGATTGGCCTCATGTCACCGTCGTGGACACACAGTCCACGACCCGA
TCTTCCTTGAGAGAGAGCGATGGCCCTCCCTGTGAAGTCTGTGCCCATGTGACCCGATCCAACTCGAGCGGCGCCCAACCGTTGCTGAACACCGAAGTGG
AAGCGCGAGCCCGGAGCTCGCGCGATGTCGTTGGCAATCTGCAGCCAACACGAGAGAAGTGCGCGGCCGAGCCAGAGGTGCTCCAGCAGCCTGAGCATCC
GGTAGAGTGTGCTGTACTCCCGGATCTCGATAGTGAGTCGGATTCTCCTTCGGAGTCCTCCATCGCGAGCAGTGGCTCGCGACTCTCCACGTCCGCAAAG
CGCCGTCGGAGAAGAGCGGCGCGTGATCCGCGTCGCGGACAGCGTCCGACTGAAGAATCCATCCAAGTAACGGAATATGGTGGTGGCGCGGCTTTGGGCT
CGCGCATGATGTCGGTCGCGAGTCCGCCTCGAGATGCCTCAGCGATCCTGGCCCTGCCGACACTGTCGTGGAAGCAGTTCCTCCACGACCTGAAACGCGA
TGAGATCGAGCAAGTGTGTGTCTTGGTTGCTGACCGTGCGACGGTCCATGTGGCAGCCGTCGATGTGAACATGGATGACTCCCAGGGGGTTGAGCGTCCA
CCTAGCGCCGAAGCCAAGTCGGCGCGCGAGAAACGTTTCGTTGCGCAGTCGTGGGACACGCTCAAGCGATCGGGCAACCCGGTCTACGCGCTTGCCCGCG
AGTTCGCGGACATCTTCCCAGACGAGATCCCCGCTGAACTTCCCGTCGATCGTGGTGTGCGTCACGAGATTGACCTCACCCCGGGATCGAAGTACTGCGT
GACGCGCCAGTGGCCGCTCCCTCCGGATCAGGTCAAGGCGATTGACGATTTCTTTGAGGCCCGCCGCAAGGCGGGTCACGTCCGCGAAAGCATCTCGCCG
CACTCGAGCCCGACGTTCTGCGTGAAGAAGGCCACCGGCGGATGGCGCATCGTCCACGCGTTCAACAAACTGAACGATGCGACCATCCCCGCACAGACGC
CAATTCCTCGTAAAGACATGGTCTTGGACACCATGTCGGGCAGCACGATCTATAGCGCCCTCGACCTTCGTGACGGCTTCTATCAGATCTTGATGTGGGA
ACTGGATATCCCGCTCACGGCAGTGAGCACCCCGAGCGGCATGCTCTGGGAATGGCTCGTGATGCCTCATGGTCTGAAGAACGCACCGGCTACCTTCAAC
CGAATGGTGTCGCACGTTCTCCGTCCGCTCCGCAACTTCGCTCCCAGCTACTTCGACGACATCTTCGTCCACAGCCAAGCGGACAATGAGTCGAAGGACG
TTGACGTCCATCTCAGACACCTTCGCAGGTTGTTCGAGGTCATGCGCGAACACAAGCTGTATGCCAACTTGAAGAAGTGCATCGTCTGCGCGCCGGAAAT
TCCGGTGCTCGGCTACTACGTCAGCGCGGAAGGTGTCCGCGCGGACCCAGAAAAGATCGCGTCGATTTGTGCGTGGCCGGTTCCGAAGGCGCAGACAGAG
CTGCGTCAGTGGCTGGGCTTGGCGAATTACTTGCATCGTTACACTCGCAACTATGCCACCTTGATCCAGCCACTGTCGTCGTTGCTGAAGAAGGACGTCA
CTTGGACATGGCGCCCTGAACACCAGACGGCCTTCGACGCCGTCAAGTCGAGCTTGATCGAAGCACCGGTGCTTGCGCTCCCGGATGAGTCGCGCCCCTT
TCACGTAGTCTGCGACGCCAGCGACTTCGCGATCGGTTGCGCACTCATGCAAGTTGACGGGCTCGGTCGCGAGCGCGTAATCAGCGCCGGCGGAGCGGAA
CTACCCTGTCCACGACAAGGAGTTGTTGGCGATGAGGTATGCCCTCATCAAGTTCCGTGTCCACCTCCTCGGTGAGAAGACCTTTGCTCTGTACATGGAC
CACGCGTCACTGCGGACCGCGACAAAGAGTCCGCATCTGAGCCAGCGCATGGCTCGCTGGCTCTCGTTCTTCTCCGAGTATAATTTTATAGTCCACTACA
AACCGGGGAAGACGAACGTGCTCGCAGACGTGCTGTCGCGCCGCCCCGACTATGACCCGCGGCGCGACTTGGGCCATTGATCGGGCATCGCGGATGACGA
GGATGAAGATTGCGCCACATGCCTCGCTTCGGGAATCTGTGCCGTCGAAACCTCGGTAGTGTCTGACCTGCGCTGGGCCATTGCCGGCGCATATATGGAC
GACACGGACCTCGCGCCTATCGTCACTTTCCTGCCCTCGCCAAGCGAAGATGCGCGGAACAAGCTTCCGCGCCGAGTCGTATCGCGTCTTGACCGATAAT
CGCTTGATGATGATCTCCTCTTCTATAGCATCGATCGGTTCGACGCACCACGCGTGGTCGTTCCCAACGATAGTGATCTTCGGGCTCAACTCATCCACGA
GTATCACGACGCCCCGACCGGCGGTCACTTGGGCCGTGAGAAGACGTACGCGGCCCTCTCGTGTTCTTACTACTGGCCTCACCAATATCGATGGGTTCGC
AAGTGGGTCCGCTCGTACGAGACGTGTCAGCGTGTGAAGCCATCCCCGTCCTCGCGGACGCCGTTGCACCCGCTTCCTGTAGCGCCAGATGTTTGGCGCT
CCGTCAGCATGGACTTCGTCTTTGGACTGCCACCCAACGCCCGTAGTCGCACGGGCGTTCTCGTCTTCGTTGACCGCTTCTCCAAGATGGTCCACCTCGT
CCCAGTGTCAGCGAATGCTGGCGCCGAAGAGTGCGCGGCGCTCTTCATCGATACGGTCTTCCGGCTCCACGGACTTCCTGAGTCCATCGTGTCTGACCGC
GATCCGCGTTTCGTGGCGGCGTTCTAACGCCGCCTCTTTGAGCTGCTCGGCACGCGACTGATGATGTCCACCGCTGCTCATCTGGAGACGGACGGCCAAA
CTGAGCGCGTCAACCGCGTTCTGGAAGATGTGCTCCGCAGCTACGCGACATCGTTCGCGTCGTGGAGCGGGTTTCTCCCGCTCGCTGAATTCGCCATCAA
TAACGCGGTCCACGCGTTGACTGGCTTGACTCCGTTCTTCATCAATAGCGCGCGGCACCCGCGTGTTCCGGTACTCCTCGCCGCGGGCCTTCCCGCGGCT
CCTCCTGGCTCCACTCTTAGTGGGGGAGAAGCTGCCGCTGATTCTGATTCTGATTCAAGTTCCGCTGATCCGCCTGATTCGGATCCAAACTTCGGCGCAA
ATGCCGTGACGCGCTCGAAGTCCAAGGCGCCCGCCGATACGGGTGCTCTCGCGCAGTGGGCATCGCGCACTCTGATAAGACCGAGCGCTGCGCCTGGCGC
AGCGCCTCCCGATGCTAACTTCGCGCCCAAGCCTGCCATGAAGCCCAAGGATACGCTGGCTGTAGACGACTTCATCAGCCAGCGTCAAAGCGTCGTGCGG
TTTGTGCGCGACGCACTTCAAGCAGCAGCAGACCGGCAGAAAGAGGCCGCGGACAAGCGCGGTCGCAAGAATTTGAACGTGTACCGCGTTGGCGATCGAG
TGCTGTTATCAAGTGAAGGGATCAAGAATGCATCAGTGACGAACTTGGGCGCGAGCAAGCTCGCGCCACATTTTATTGGCCCCTTTCGGGTTATCAAAGC
ACATGGAGACGCATACACACTCGACATACCTACGACGATGCGCTTGCACCCGACATTCTATGTCGGTGCCTGAAGCCGTACAAGCCTGCAGAAGTCCCAG
CCGACGAGCGTCGGCGCTTGTCACCTACATCCGGCTCCCCAGCTGACGCTCGAGAACCCGAATGCGCTCAAGAAGATTCGCGCTGCGCTGCTCCGCCCGT
TCCGCGCGCTGGGCTTGTTCCATCGCCTTCTGCGCGTTGTCGCGAGCCTGCTCCGACTCAGCGAGCACAATCCGATCGAAGTCTGAACGCGCCGCGTTGC
GCGGCGCATGTTCCTCTTGAGCCGTTCCACCGCGATGGTCCTCCGTCGCTGGTTGACTCCACTGGCGAGGCCCACTGGGTCGTGGGTCACATTGTTGACC
ACGACGATCTTGGTATTGCTCCCACCGGCTCCAGTCGTAACCGGGATAGCGCCGTGCTTGCGCGGCACCGCTATCGTGTCCGCTGGTTCGGGTACCCACC
AGAGGCTGATACATGGGAGCCGCGTGAGCGGCTCGAGGGCGACGTTCCGGATATTGTTCACGAGTACGAGTCCA