Description :
From Genome Similarity Track
Location :
Scaffold_229:311- 2944
Transcript NameFunction/comments
Phyke_g8270conserved hypothetical protein
Phyke_g8271hypothetical protein PHYSODRAFT_561698

Sequence
2633 bases(100 bases per row)
GAGTAGCAAGCCATTAGGTCAGATAAATGCTGCTTTTATTTTTGTGTAGTAACGATAAGCTATCGATCCATATTTCACCTGGCATCCACATTAAGTTATT
GATGCCGTCATTGTTGAGTTCAGTGTCGCTTTCggctgaagaaggcgcgcTCTCTCTCCTCGTAGGCAGCTTGTTTGGCCATGCGCTGTTGGAGCATCCG
GGCGCGGAAGTCTTCGTAACGATCAGATAGTGGCCGCGGGCCGCCAGCTTCTGCACTCCACGAGAGCACAGCCACGACGGTGAAGGCCATCAGGAACACA
ACACGGTAGGcctgcttcattttcgacACTTGGGTATTCGGTTGAGATTGGGTGCGCTGGATGGGGAGTGAAGGTTGGAGGCTTGAGGGCTTTTTGGTTT
GTGATCTTTGAAATGGGGAGGGAAAGCTCACCTATCGTCCTCGAACCTGGCGCTGCTCAGAATAACATTGCTTGCCCTGCACCAATTTTAAATGCTTGCC
GGCCGGTTCTGGTATTAATGCTCTTATCCTGCAACACCAAGTGGCACGAATCACGTCCACGTTTGTTGTGATCTTTATTTATCCGTCCCTTTATTTAAGA
GCCCAtggagctactgctgctacctTGACTACCACGGCTGCGGTTGCGGCGAGTGGTGTTGCTTGCCGGAAGCGGTGGGCTTGCCgcgtcggtggtggca
cTGGCTTCTGGTGGCACATACGCCATCATGCGGATCCAACGTCGGCGGCGCACCGAAGCACCCAACCGCTTCATACTGGATCTACCACGAGCTAGGTGAA
ACTTGAAGCGCGGGAAGTCCGTGGCGTAACTCCAGCCTTCGTCATCACAGTCCGTGTAGTTCTTGTCAATGCGCCAAGGagtcgtccagctccagaggGG
AGGAAGAGACACCTGCTCAAAACTCATCGCTTTGTCACCGTCTCGATTCGAAAAGCGCGGTCGATCCGTGGGCAAGAGGTGGTTAGGCGCCCACTTTCCA
AACATGCTCACTCGCTGGTTTTCAAAAATCTCCTCGAGAGCTACACTCCCGTCCAGCGTGCTGTTGTATCGAGTAACATTCGGGTGGCGACGAGAGATAA
CTCCTGTAGAAGAACTTCTCCGCGGACGGCCGCGAGCCCCGCCATCGTTATTGGCGCTGGCGCTATGGCGCGCACTCTCGGATGCATCAGTAGATTCCTC
CGCATCTAACGCTTTCTGAAATCCTTCGAAAACCATCTTCGCGCTCTTCACAATGCCCTCTTTGGTAACGGATTGGATCTTTGACTTGAACATAGTGCCT
TTCGAAAATGGGATTCCCACAAACACCTTCGCCACCAGCGGTGACCCGATGGCGTCAGTGCGGGGCTCAATCACATATATGGTCTCGACGTGGAAGCAGT
CACCGTAGGGAATATCAAGTAGCCAGAGCTTGTGCTCAACTGTGAGTCGATCTGCGTCCAAGCTATCGCGACCTTGCGATGAGAAAGGCACATGAACAAG
CTGTTGCGCCATCGTTGTAGCTGGCCCGAGGGACGAGGTACTTTTGGCGCGGTATTTCATCTCGCGTACTTGTCCGCCAAACTCCGCCGAGTCTTCCCAC
TTACCGACAACATGCTCCGTGTCCCCCGCTTCCTTGTGAATGTTTTGCCACCGCGATAATGTGTTGTCTGCGTAGAATAGATCAAAGAAATGCAGTGCAT
CTTTCACTGCCGGGTGCAAATCGAACTCGCCAATAGGCTGTCTTTCCTCCTCAGTAGAAACCAGAAACGGTTTTATTGGTGTTGCAGCCTGTGATGCACT
TGGGTTTTCCACCGACCGATTCACCACATGAAAGTACAGCTTTGACGAGCTCACCATAGCCTCGCGTGTTGCCGATATGATCTTTGACTTGAACATGCAT
CCTTTTGAGAACGGGACACCAAGGTAGACCTTGGCTACCAGTTGTCCGGGACTACCGTCGTTAGAGGGAATGCGTTCCACCACAGTAACTTTTTCCACAG
TGAAGCAGTCACCGTAAGGAATGTCGTGCATAACCGCCTTTGACTGCATCACAAGCTTCTCAGTGGCATCGAGTTCACACTCGACGAACGGTACGTGATC
TGTTGTGGTTAACATAGTATGCGATGGTCCGATAGATGCATTCGTAGGCGAGCGACAACTCACTGTGCGCACTTGGCCACCGAATTCCTTGGAAGCAGCC
CATTCGCTGACTTCTATCTCTGAGTCACCGCGTTCCTCGTAGTAATCATTCAAGCGGTCTGAAGTGCCATCAGCCAAAAAGGTTTTGAAAAAGTCGTAGC
CATTAGTCAGTGACGCGTGGAGAGGGTACTCGCCAACCAACTCGCGCTCATCGGTGGAAGTTACGAGGAATTGCGTAAGCTCCGCGCCACCAGCACTGTC
AACTGAGTACTTCAATGACAGCAGTAACTGACCAAGGATAGCGTCGCGGGTAGATGTGACAGGCCATGCGCACGAGAACTCAGCTGTGCGCATACCCGTG
AAGCCTAGCAGCTCGCGCAGCGACAGCGAGACCTCACCGATTTTTGTCGTTAGATAGCGCAAATGAATTTCATATACGTGGAGCACCATAATGTCCGGCA
GACCACAAAAGGCACCAGAAGTCGCGCCCAACG