Description :
From Genome Similarity Track
Location :
Scaffold_1:3108978- 3114622
Sequence
5644 bases(100 bases per row)
TGGCAAATATATTAACCAAAATCTTACGTTACGCCTCTAGTAGCCACTATACAGGTTTCTTTTCACACTAGCCCGGGTCAATATGTCTCGAAAACGTCCC
GGGGCGCGAGGAAACCACTTGTAATTTTGCTGTAAAATCCGTTCTGCTTGATGTTTATTCATATGAGCCTACTGCCTACCCTTCTTAACAAGCATCCTGC
GCCTTCCGATTACCCATATTCAGATCAGATCGCCTCTTATCATCTTCGATCAGGCGTCCGCTCTCACAATCGTCAACTGCGGTCCTTGATCAGCCATCTC
GCCTCTGATTGATGATCTTCGTTTCGATCGGGATCTTGATCCTGATTGATGATCTTCATCACGCCTGGCGATCTTGATCCAGATCTGCTACCTCCGTAAA
TATCGTCGATCTTATTCCCCTTGATCGCTAATCTTATAAAAATGTATCGCTGACCTCACCTAGCTTTTCACTCCTTCGTGTCGATATCGACCCGCGAAGC
CAAACTAGTACAACGTGTCGGGACGAAAATCGATTCCATACAGCCGATTCGACCCCCGATCCGTACCATCATCCAACACAGCAAATTACACAATACTTTC
TTTTCTTTTAACTAACCTGATAATGTGTTGTGTGTCCGCCATCGACCAAATCCAGCGCGTGGGGCGGCTTACTAAGGGTAACGCGAGTTTCAAGTCTACA
TTTTAGTAGCTCAGAATCAATGCAGTACATTTTCAGCGTCACCAGTCCATCAGTGGCAGGGAGGGTATCCGAGATGAATTGCCAGGGATCTGTCACGCGT
GATACAACTTTATTGCTTCTTTTTATGCTTGTTAACCTCTCCGCGAGTGATGTCAAGTAGTTGCATTGTTGTCCCCACAGCTATCAGACAACCTACTGCA
AAAGCAATTGTGCGGCTCACTGACTACGCAGCCGTTTTTTTATTAACCAGTGACTTTCCGGATTGCTTGCCGCTTCCAATAGTGGGGCCAAGCTTGAGCA
GTCAAACACTCTGTCCGATCAAAGGTGGTTTGGCCACAAACAACACGGAGTTTTCCTGGAAGATGGAACGGCTACCCAATACATTGGCAATGGTTGTATT
GTGGGTGCACGTACACCACCACGATACCTGGCAACTTACGCACGACCTACAACGTTGGTTTCCGCATTCAGTTGTCAACTACGAGCGACGCTAGGCTTGT
CTTTCGGGACCGAATCCCTGACACTCTTCTCTCGGGGGAAGTTTGTGTCATTGTTCTGGGGGTAAGGCTGTCGGCTTGGCGCTGGAATTGGATCTGCATG
TGACCCGATTCTTGTCGTTGTAAATGACATGGAGGAATCTTCATTTTCATTCCTAGGATTTTCATTGTCACCGGTTCTTTCCGTATTGGGGTCAGCATTT
ACGATGCTACGAGAAGAAGTGGAGATTCTTTGCGTATTCAAAATCCTTTCCCACATTTCAACTGTGACTTCATCTCAGTACTCTCCAATCTCCTCTCAGT
CGAAATGCTCAAGATACTCGTCTAGCTGCCTGTTGTAATGAACAACTGCATCGAGTTCCCCGGCCAAATTTTTGATGGTGTTATTATGAGAAGGAGCCGC
TTGCTGTCGAATTTACCATTTACGCGTGCATCAGTGGGCGAAGCTGGCGAAGTAGTTCGAGTTAACGCAGGGGTATGACGCAGTGGGGTCGGGACGGACC
ATTGCCTAACTCTATCACCAGAATTAAGTCAACGTCGCGCAAAATAGGAAATAAACGTGCGCCAATGGCGTTGACTGATTTTGGACTGGAGAATGTGAAT
GAGGAGATTCATTACCTCCATGGAGTTCACGAGCAGGCGTTCGCGTAACAGCAGATGTTGGTGGGGCAGTTCAATTCAAGGCCGGTGTCGGGTTAGCCAG
TGTTGTCTAAGCAGAGTTTAGCGGCGTGGCAATGCGCTGTCGTTCTCGAGGGTCAACTGTTTGAAGCAGTTTTTTTAGAGTTTACTGGCTTCGTTTTTTC
GAAGCGGTATTTTTCACGAACGTATTGGCGCATTATATGGTGCTTCATGGTTATTTCAACTGCCATTCGATTTGGCTTCGGGGTCTGGATCAGTGCCAGC
TCACTGAATATACCGAGAGTCGCTCTGCTCTCAGCCAATCCAATAACAGAAATGTTGCCATGGTAACGGCAATGGACCTTATTGTGAGAGCAAGCAGAGG
CAGGTTGCAGATCTTTTTCGTTTTTTTTTTCTCGTACTCCCAAAACGTCGACACAGCATCACCGTTGAAGTCAGTAGAACGTGAAGATGTATAAGTTTCC
TGAATCCAATCGAATATTTCACCGCGTAGCCCACTGTCATCGTCATTTACAATGCGTCGAAAGTAATATTGGCCAATTTGATACACATCGTCCATTTCAG
TAACCACAGTTGGAGGTAAACTTCGTGCTTCTACGACATAGTTAGGATGAAGATGGAACCCTAACATAAAGAGGGGTTGCTCACAGGCATCCAACGAGCT
TCCACTAAATCTGTGAGGGAATCACCCAGCTCTGTCGACACAAACCCACGATAGATATCCATAAATGAGATAACCACATCGGCTACGGTATTTTCGTCCC
TTTGGAGACGAAATGAAGCGGTACGCAATGGTTTACAATTTCCCCTGCAGTCTCCAACTTCGTCCAGAGCTCAGCATCCCCTAAAACTCGAATTGTGTCC
GTGAGATCCGGGCCGGTATGTGAAGGCCATATCTTCTAAGGCTCCGCGTACACGAAGTAGTGAAGCAAAATAAGCCTGCATAGAGTTTCTACTAGTTTCA
CACAGCGTGAAAACAGCAAAATTATCACCATATCGCTTGCGCATCGATTTAGCAGTCCGAACCAGCCATTTAGCAGTAGAAGTATTCAGAAAATCGCTAC
TTCTGCAGCTTCTTCGGAAACCTTTTTAAACTCCAATTTTATAACAGCTTTCACCAGGCTGTTGATATCGTGTGCGAAGCAATGTAAAAAGACGATATTT
GGGAAGCGAGGTGCCAATATACGACGTGCGCGGCTACATTGGCCGGCATTGTTAGTCACAACTGCACCTACTTTCAGTCCCCCAAGTGCTTTTGCCAGGC
TTCTTTGCGTCCATTGACATGAGTCAGGAACGGTATCATCGATCGGTCTTTGACATGAGCTGCGTAGCAGTATTTACACACCGTCCACCACATGGTCCTG
TTGCACCGCTCATTTAAACGTTAGAAATTGGTGCTGAGGGTGCTAGGAGGGCGTCCACGTTTGGCGGGGCCCGATACATTTTGCAGTCCAGGAAGTAGAT
CCATGAGAGCGTTGTAGCTTGCTCCACAGGTTCTGCAGTGACAATAAATTGCAAACATGCGACAAAATCGTTTTACGTCAACAATGTTAAAATGCTGTGT
AAAAATGTTTTAAATGTCGTATCAAATCCTTTTACGTGAAAATGTAAAAATGTGAAAACAAAAAATTCAACACTGCTAACATCCCTTCATTCCCACTGAC
CAAGCTTCTATGCGTGCTCGCAGGCCGCGCATAGCTACACGTGCCCTTCAGCTCGACTTTATAAATCAAACAAAGAAATCAATACTTCCCAGGAGTGTCC
TCAAACGTTTTACAGACTTGTTACCAGCTATTGGTGGGTTCAAATGTCTGATATGCTGCCTCGCCATGGAACACATCTGAAAATGAGGTCCAATTAGCCG
GCAATGAATGGCGTTAGAGCACCATTAGGTTACAACAATACGACAGCCTACCAGCACCCTTATCGCACTGCGGCGCCATTTTTACTGAAAGGCACCCTTA
ATAACGAGAATAAATTACCAACAATTTAGCGTAAAGAGGCGAAGTTTCACAGTAGTGACATCGCCAGTGAGAATTTTACAACAGGGGCACATCGAATTTT
CAGTTTCTTTTAATATAAGCTTACAAATACAAGCGCGAGCCGAAGAAGAGTGTCGGCATGGATCAGCAATTATTGGTACGCGAGCTCCTGCGCTCCAGAG
CCCACGAGCTTCAACAGCTTCAAGACAAGGTGCACACGATGACGGAGGCGCTAAATGACCTGGTGTCGCTCGCGAGGAGCTCGAAGAGATGCTCGTACGA
GAAACAGAGGCAATCAACGAGCTGACTGCAAGCGTCGAAGAGACCCCTGGGCGAAGTAGATACACTCCATCTTATGGAGTTCTGCTGGGGCAAGTGGTTA
GGCTACTACGGCGTGATCCTTCAGGGCAGTGAATCGGTGGCATATGATTAACAAGCGGATTTTCAGAGTTTGTATGAAGAGTGCAGTTTTTTTCTTCTTT
AAGATTATAATCTCACTGCTGCCTGTTGAGTTCTTGCTCATTTTGCTGACATAACCTTGCTAATTGCTTCATCTGTTTCATGCATTTTCTCGATGTTCTC
TTCACTACGCGTAGCCCTCTTTGTTGTGCAGAACATTATCTCAATCTCATAACGCCTTCGTGATACGATGACGCTTGAACCTTTGGGAGTTACGCACGAA
TGCGTAAGTCATTCCAAGAATCATAAGACCGCAGCTTGAGCCGTCGGGCTGCGCAGGTTCGCTAACCCACCTCTTAATTATTTCTTTCGAGAATGACTCC
TTGGCTCCACTTTCTGAATGCCAATTCTCCAAATACGGTAGCAACTTGTCCTTCCACACATTTTTATTTCTGCCCGATATCGCTGCGGGTGGATTAGCTC
GTAGAAATTAACTCTTAGCGTCGTAGGAAATGCCACCTCCACAATGATAAAACCCCAGTGTATTCTGCTAAGATGTAGTGGTAGAATCACGAACGGTGTC
TCAGACAGCCATAGCTTTGGATAATTAGGCCATACCATGATCGAGGACAACGCCACACACCCTTCGACACAATCCGCAATGATATTGTTGTCCATATCGA
TCACTGCATCATTCACCATCACGTCGCGGGGTAATCCAGCAGCAACATCAAAAAAATTGATAAACGAAGCCCCGACTTAGTCTTCGATATGGTCATGAGC
GATAGTGGAGAGTACTTCTTCAGAACATCTTCCACCAGCGCTTCATACATTCTTGCACTACCAGAATGCAGCAATCCACTTGTTTTCGTCTCCAACGAGA
AGGGTTCGACAGGGTGGGCTTGAACTGTGCGCCACTCTTGCTTGAGCCACTTTGTATCTTCAATAACCCCCCTCGCTCTTGCCTTTAGAATGTAGAACTA
CTTCATTCTGTTGAAAAAAAAACTACGGCAAAATAGCAAAGTGAGACAGAGACAATTAAATAGAGAAAAAATGGAGCACCCTTATTTCTAGTGAAGCACC
CTTAATACGTCAACAGAAGGTTCCACATACATGTGCAGAGCACGGTTTTTCGATGATCCAAACGAAACCAGCAAGCCCCACGGGGCATCCTCCTCTTTCT
TCGCGAGTGAATTCTTCTTTTGCTGAATCGCCGCATCAGCTTTTTTCAGTAAAGCTTCTGGAATAACAAAAGGTTGATCAATGACCTTGTTCTCGCTGTC
TTGATGCGCAACCTCACAAGTAACAAGACGAGCTTGTAAAAGCTTGTCTGTCATCCTAACTGGGTATTGGCCAAGTGCATTTCAAACCCTCTGCACATTT
GGACAAAAGCTAGCCCATTGTATGATTTGAGTCAAAGTCGTGGT