Description :
From Genome Similarity Track
Location :
contig_120:31084- 32713
Transcript NameFunction/comments
g13929.t1hypothetical protein

Sequence
1629 bases(100 bases per row)
GAGAGGAAACCTAGGAGACTCGGAGGATTAATACATTTGTTACGTTCGGCTTAATTTTGTGCTCGCAGCATTTTTAAATAACGAGTAATGTAGTAACTAC
GTTGGTGCTTCTGATTTGTCTCTTAGCACTGGTGATTTTGCTCAACACCGATTTTGGATGAAACCAGTACTTGGGTTAGCTCTCGGTACCGTAAAAATAT
GTTTGGCTATTTTCTTTTCGCAGCCTATTTTAATCTAGTGGTGACTGCCGAACAAACAGCTAATCATGACAATCGTTAGACTCTACCACGTCACTTGTAC
AAACCATATTAGACTAAACGGTAAAATTGACTGCTCCGTGTAGTACAGTTGAAGTTATTTTCAACTTCAACTTTGAAGATACTTTTCAAGCGCAGCCCTG
ATCCTGAATAAGACTGACGAGGGTATTTGAAGCTAGTGGCTTTCATTTCTATCCGCATAGATTATTTTCTACAGACGAAAATGCAGTAGGCATCACAGGT
AGGGGATATTGTCTGACAAATAAATATTTTCAAATCGCAGCCTATTTGGAAGGGTCGAACGATTGAAGTTCTTGTGCGTCATTTACACTAGTACATACAC
TAGCGAACAAATTGTATAGAACAAATAACCACTAACATGTCGCTCTCTATCACCAACAACGAACAAGTCAGATAGCCAAGTGAGGACACATTACTTCATA
TTTTTAATCTTTGCACACATAGTCATCCCTACTCTCTCTCTAGCGCCTGGCCAATGTTGCGCGGTCGACCAGCACTCCCAACTGCACCTCTGCGCGCTTT
TGCGCCGCGGTTTACAAGCGTCTCTCTTCCTAGAATGTCCGTAGCGCCGTGACGCTCCAATGCATACAGCGTGTGGATGCAAGATCCGTACTTGTTCCAG
AAATTGCAAGGACACGACCTGGATTGCATATCTACAGGCCAGCCCGACGCAGGCATTCCCCGTGTCTCCATGTTAGCTGTAAGCTTATTCAACTGCGAGG
AGATGGGTAGATCTTCTACCGTCTTGCGCCTTGTCTCGTCATAAACACGAGGAGAGGGACGACTCAAAACACGAACAACGTCACACGACGGGTCCTCAGA
ATCGTCTGACAGTATGAATTGGATGCTTGTTCTTGAGGTAGAATGCACCGACAGTAAATCTGCCCGAGTCATCGCTCTGACTCGACGCACAAGTCTGGCT
TCAGGCTCACAGGTGGCTGTAAACGTCTTGGCCGCCACACTTTCGCTCTCACATAGGGTCCGAAGCAGTGGGATGAGAGCACCTACCTTCATCTTGCGGC
GCAACGTGATGTCTCTTTTAATTGCAGCGTTGTATGTCTCACAAGGATTGTTGGTGGTTGCGTAACCGCTGGGTGTGTGGAAGCACTGCCATCGCCAAAA
GCGTTGGTTCAGCCATACCTTGGAAAAATACTTTGAGAAAGCTGCGAGGTCCTTGTTTTTGGCCCAGCTTTCTTGCACCAGAGCAAGCTTATCGTGGAAG
GCTGCGTCACTTGTCGTGAAATGCAGGTCATGGATGTCTGCCATTACAGATTCTGCAAGGTTGCACGCCATGGACCGCGTTTTCTCAAAAATCTTCTTGG
CCACATGAAAGTAGCACATAAGGTAAATG