Description :
From Genome Similarity Track
Location :
Scaffold_26:310794- 312458
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009457Similar to SLC9A8: Sodium/hydrogen exchanger 8 (Homo sapiens)

Sequence
1664 bases(100 bases per row)
AGCGAGGACGACGAGAAGCGCTGGACGGGCGCCGAGCTGCTCGCGTGCGCCGTGACGCAGTTGCTGCTTGTGAACGTGGCCTACCGCATCGATCGCCGCA
AGCAGGCGCCGCTGCTCTCGACGTCCGCATGGGCCATCTTCCTCGGCCTCGTGGTATGTGTACAGTATCTACGCATTTTGTGTGTGGGCCGCTATACATG
CGCGTGTATACAATAATGTGATCGCTTTATTGTGCGCTGTAGTGCGGTGGCGTGCTCTCGGTCATGTCCAAGACGCGCGTGCACAGTGCGGGGCTGGACC
CGCAGACCCTGTTCTTCGGGCTGCTGCCGCCGATCATCCTCGAGGCGGGCTTCAACACGCAGCGCAAGGGCTTTTTCTCCAACTTCTCGGCGATCCTGCT
GCTCGCGGTCGTCGGCACGCTCATCGCGACATTCGCGACGGGCGGTATCCTCATCTACCTTGGCCGCGTCGGCGTCATCACGGAGCTCACGTCGGCCGAA
GCGTTCCTGTACGGTTCGCTGATCTCGGCCATCGACCCGGTCGCGACGCTGCTTGTGTTCAAGAAAAGCGAGGCGCCGTCGCTGCTCTTCAACCTCGTCT
TCGGCGAGAGCGTGCTCAACGATGCCGCGGCGATCGTCATCTTCACGCTCTTCAAGCGGTTCGTTGAGAGCGGCAACACTGAGGTGACGCTCGAGACCGC
GTCGTCCATGGTGCTCGAGTTCGTCAGCATCGGTGTCGGCTCGGTGACGCTCGCGGGCGTCATCTGCTACAGCTCGGCGTACCTGCTTAAGCACTCGGAT
CCGGCGCTCAAGGAACACCCGACGTACGAGATCTCCATCATCCTGCTCTCGTCCTACGCGAGCTACGTGACAGCGGACCTGTGCGGCTGGAGCGGACTGC
TCGCCGTGTTCTTCAGCGGCGTGTTCATCCGCCACTACCACATGTACAACATCTCGAGCGCGAGCTCGTTCGCGTTCAAGCACCTGCTCTCGACCTTGGC
GTTCCTCTCGGAGAATTTCATCTACCTTTACCTGGGCATCAGCGTGTTCGCGTTCCGCGAGTCACTCATCTGGGACTGGGGTTTCATCATTGCCAACCTC
GGCGCGTGTCTGCTCGCGCGCGGCCTCAACACGTTCCCATTGTGCGCGCTGGCGAACTTTGGCCGCAGCACGCGCCGCAAGATCCCGTTTTCGCACATGA
TCGTGATTTGGTTCTCGGGACTGCGTGGCGCCATCGCGTTCGCGCTCGTACTGAACGTCCAGACAGCAAACCCGGAGCACGCGGCTATCCTGAAGAGTGC
GACGCTCTTCACGGTGCTGTTCACGACCGTGTTCCTGGGCATGGGCACGAGTCCGTTGCTGTCGGTTCTCGGACTCAGCGGTGCTGCTGAGGAAGACGAG
GAGAGCAAACGCATCGACTCGTTCGTGCCAGGGGACCTCTCGTGGATGGCTGCGGACAGCGTCAGCGGTGTCAGCAAAGCCTCGGATGAGCACCTTTACT
TGCTGGGCAATGGCCATAATGGCGTCATGAGCAGCAGCAACAGCGTGTATCTGCTGGCCCCCACGATGGGCGACTCGCCGCCAGGATCACAGAGCGTGCA
CGACGCCTGGGTCGAGATCGACGAAAAGTACCTCAAGCCGCTTTTCGGAGGCAATCCGCGGCCA