Description :
From Genome Similarity Track
Location :
scaffold_120:31075- 32705
Sequence
1630 bases(100 bases per row)
TCTGAGAAAGCGCGGGTGGGGACAAGCGCGAAAAGGGACAAGAAACGCAAGATGAAGGAGAGGATGGAGAGGGTGCGAGCCGCTAAGAGAGGAAACCTAG
GAGACTCGGAGGATTAATACATTTGTTGCGTTCGGCTTAATTTGTGTTCGCAGCATTTTTAAATAACTAGTAATGTAGTAACTACGTTGGTGCTTCTGAT
TTGTCTCTTAGCACTGGTGATTTTGCTCAACTCCGATTTTGGATGAAAGCAGTACTTGGGTTAACTCTCGGTACCGTAAAATTATGTTCGGCTATTTTCT
TTTCGCAGTCTATTTTAATCTAGTGGTGACTGCGGCACAAACAGCTAATCATGACAATTGTTAGACTCTACCACGTCATTTGTACAAACCATATTAGACT
AAACGGTAAAATTGACTGCTCCGTGTAGTACAGTTGAAGTTATTTTCAACTTCAACTTTGAAGATACTTTTCAAGCGCAGCCCTGATCCTGAATAAGACT
GACGAGGGTATTTGAAGGTAGTGGTTTTCTCTTCTATCCGCATAGATTATTTTCTACAGACGGAAATGCAGTAGGCGTCACAGGTAGGGGATATTGTCTG
ACAAATAAATATTTTCAAATCGCAGCCTATTTGGAAGGGTCGAACGATTGAAGTTCTTGTGCGTCATTTACACTAGTACATACACTAGCGAACAAATTGT
ATAGAACAAATAACCACTAACATGTCGCTCTCTATCACCAACAACGAACAAGTCAGATAACCAAGTGAGGACACATTACTTCATATTTTTAATCTTTGCA
CACATAGTCATCCCTACTCTCTCTCTAGCGCCTGGCCAATGTTGCGCGGTCGACCAGCACTCCCAACTGCACCTCTGCGCGCTTTTGCGCCGCGGTTTAC
AAGCGTCTCTCTTCCTAGAATGTCCGTAGCGCCGTGACGCTCCAATGCATACAGCGTGTGGATGCAAGATCCGTACTTGTTCCAGAAATTGCAAGGACAC
GACCTGGATTGCATATCTACAGGCCAGCCCGACGCAGGCATTCCCCGTGTCTCCATGTTAGCTGTAAGTTTATTCAACTGCGAGGAGATGGGTAGATCTT
CTACCGTCTTGCGCCTTGTCTCGTCATAAACACGAGGAGAGGGACGACTCAAAACACGAACAACGTCACACGACGGGTCCTCAGAATCGTCTGACAGTAT
GAATTGGATGTTTGTTCTTGAGGTAGAATGCACCGACAGTAAATCTGCCCGAGCCATCGCTCTGACGCACAAGTCTGGCTTCAGGCTCACAGGTGGCTGT
AAACGTCTTGGCCGCCACACTTTCCCTCTCACATAGGGTCCGAATCAGTGGGATGAGAGCACCTATCTTCATCTTGCGGCGCAACGTGATGCCTCTTTTA
ATTGCAGCGTTGTATGTCTCACAAGGATTGTTGGTGGTTGCGTAACCGCTGGGTACTGCCATCGCCAAAAGCGTTGGTTCAGCCATACCTTGGAAAAATA
CTTTGAGAAAGCTGCGAGGTCCTTGTTTTTGGCCCATCTTTCTTGCACCAGAGCAAGCTTATCGTGGAAGGCTGCGTCACTTGTCGTGAAATGCAGGTCA
TGGATGTCTGCCATTACAGATTCTGCAAGG