Description :
From Genome Similarity Track
Location :
Scaffold_122:31026- 39405
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_122-snap-gene-0.34EML5 (ISS)
Pytir_DAOMBR486maker-pir_contig_122-snap-gene-0.35Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_122-fgenesh-gene-0.3Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_122-fgenesh-gene-0.14Cullin-associated NEDD8-dissociated protein

Sequence
8379 bases(100 bases per row)
GATCCACTGTGCTGCTGGTGCCAGAAGAGTGCGCCTTGATGGTCTTCTTGAGAACAACCCTTAGTTCATTGTATCCGACAATGAGGAGCTCTCCGTTGCT
CATCCCGACCGCGATCTCGTCACCAAACGGCTGGAACTCCATACAAACAGCTCTATTCGTACTTGCTCCACTGCCGCCACTGGTTGTAGTAAAATGACCC
CCGAGGCGCATGCGCCGCTTGCAGCGATGTCGTCGCAGGTCCCAGACGCAAATGCAGCCGTCCTGCGAGATCGTCGCGACTTCGTCTTTCGCAGGATGGC
AACTGCAGGCCACGACGGCGCCACTACGCGCTTCGAAGACCAATTTCCACTCGTCCGAGGCAATTGACAGTTCCCAGAGGCAATTCGAGCTGGTGCCCAC
AAGGATTGCCTTGCCGTCGTCTTTCCACTGCACGCTCGTGGGCTTTGGCTGTTGCCCTGCTCCATTGGGACTTCGATCACTCTCGCCTGGCAACGCACTC
GGGAGCTGGAAAGTCCGGGTGTCCTGGTCCACTGGCACGAGCTGATGCGATCCCTCCGAGAACGTCCCTGCCAACAGCGGTGTGAATAAACCCTGGGTGT
TCACGCCAGGCACGCGAACAGAACGCTGCATGTTGCATTTCCAGAGCAGCAGCTTGCCGTCTCCGCCGCATGAGACCACGAGTCCGTTCTTCTTGCAGAA
CGCGACCTGGGTCGCCCCCTCTTGATGTGCAACGGGACCACTGTACTTTAGCTCGCGCAGTCTCGCATGGAGAGTCGCCGAGTTGGGTTTCAGTGTCAGC
CGCTTCATGATCCCGTCGATCTCGGCCTGCGCCTGCTTGGACAATTTGAACCGATTGCCTGTCTCAGGATCGTGCGGTACGACGTCTACGAGCCTCGCAG
TCGGCTCGTACGCGATCTTCTCCAGTACCAGTTCGTTGATCTCGGCGTCTGTGTACTCGTCCGGGATCTCCCACCATTTTGCAGGCTCGCTTTCCTGAAT
TTGTTCTCGCTGTTCGCCGTTACCATTGTGTTTTTGTAGCTGTAGCTGCTGCTGTTTTTCAAGCAGCGCGAGGTCAACTTCAGGACTTTTGCGAGGCTGG
TAGAACACGCACAAGTCGCCCTTTGCAGTGCCCGCGATGATTCTGCCCAGCGTGTGGTCGTTCTGGTTCGTCGCGACCAGTTCTTTGCGCTGCTCGTCGT
ACAAGTAAATCGGTGGCGAGTCGTCCACGAACGCGAGACACGTGAAGTCCTGAACGTCCAGCCGCCCATGAAATGACGGCACATTGCCCTCGAGCTTCCA
CATCTTCTCGTGCGGCGTTGGTGGACGCAATCGTGCAGGAGACCCAAACGCTGATCCGTAGAACGCAAAGTCCTCCTTCTCCTCGTTCGTGGGGGTGACG
TACTCGGTCTTTGTCAACGTCCAGAAACGGATGTGGCGAACGCCGCAGCTCACCAGAGTGTAGCAGGCTTCGTCGTCATTCAGCGCCTGACCGGGTTTCT
TGGCGTGCCTCGTTTCGGGCCGGCCGTACGCTTGAAACGGATTGAATGCGAGCGTGTGCACTCGGAAACTGTGGCCCCTCGCCGTCACCAGCAGGCTCTG
TTCTTTCCAGTTGTGGATACAGATCGTGTTGTACATGTCCCCACCTAATGACGCCACGAGTTTACCGTCGTGCGAGAAGCTGATCGTGCGAACAGTGACC
GTGTGACCAGTCAATATTGTGAACCGTTTCCCCAACGGATCGTCCTTGGCATTCCAGACCAGCAAATGGGTTTGGCGTCCCGCTTGGCCTGACGCGACGA
TATACTGGTTCGGGTGCACCCCGACGCTCGTGACGGCGTTCGTGTGCTCTCGGAAGTATCGCTGCGTGTTAGTCTCTTTCGTGTAGAGGACCACGAGTGC
CGCTGTGAACCACATGACCTCACCGGTCGCCAAGTAGAAGACGCTGTTGCCATTACTGGAGCCTCCAGATAAAGACGCACCGGTCTGGAGGCCGTAAACG
AAATCCAGCTCCAGTTGAGACTGTGGCGCTGGAAGGAATGATGACGACGATGATGGTGATCCAGTCGTATCTGCTGGTGAGCTTGAACTTGACGTTGCTG
AGACAGAGTCGTTATTGTCGTAGACGCTCGGTGCAAACACATTGCTCCGGCACTGTGGGTACTTGACGAGTGCCTTCTCGTACATTTGCTGCTTCTGCTG
CGCCGCGAGGATCGCATGGAGCCCGTCCACGCGCTTTTCCATGTGTGCCACACGCGGGAGTTTCTTGTCTGATAGTTGGTTGGTTGAGAGATATTGAGAA
TTTCTCATGAGATCTCGTACACACTACCACGAACTGTTATGAATAGCGTACGTACCAAAGACGAGCTTGCCATCGGGATTTCGCGCGTCGTCGCTCGCCT
GCGAATTTGACAGATTGCTGGCGCCGCTGCTCAGCTGTAAATGGTGCTTCTTCCGGTTCGTGCCTTTCAACGCAGCATTCAATCTAGTGAGTTTGGTTTC
CCATACAAACAGAGTTAGTTGAAGAGCTCCAATAATAATAACACATCATGGCTCCATAGCAGTAGCTACAGCTCACTTTGGTAACCTTGAGATCGGCGAC
GTCGACACTGAGCCCGCGATGTTGCCAGCCGTCACAATTGGGTGGATCGCGACCGTGCCGGTCGTTGGGTAAATATCTTTGGATCCTGCTTTGAATCCTG
CTTTTGAGACCGACTTCATCCACGAGCGCTTGGCGTTGACGTTCCACGTCATGTCCTCGAGCTCCCGCAGCACCTTGGCCATCTGCGACTTCATGGCGTC
GAGCATGTCCGTGCGCTCCCTCAGCTGCTTGTCGATCTCGCCCGTCACCAGGTCTGTGAGCCGGTGCTCGTACGCGCCGCTATCCTCTGCAATTGAAATG
CCCATGCGCACGTACAGAGAGAGAGTATGGAGGATAGTTAGTGGCACATACAACAGAGACAGACAAAGAGGTTCACATGGAGTACTAGTGTAGTAGAATG
CATACCCATCGTGGACCAAAGCGCATGTATCAATCGACCACCGTCTTCGCTTTCGTGCTCAGCTGCTGTGGTCGCTCTCTTCTCAGTACGCGACGTCACT
CACTGCACCTTGCATGGTTGAGTCTGGCAGTGCTGCGCCTCTTCAACCTTACAAAAAGATTGCTAAGAATAGCGACTCCAGTGTGTCTGTCCGAAGGGTC
GTCCTCCAGGTTTCCAATACAGACAGAGCATCATGGCCTTCACACAAAAGTTTTCTGGATCACAAGACGCATCGTGATAGCTCGCTTGATGGGATCGCTC
GCGGTGCTTTTTGTGCTGTGCCTCAGCTCGTTGATGCTGCTCACGATCGGCGTTGACGGGAAGAAGCAGATCGACTATGACGCGCTGGAGAGAGCATGGG
AGGCTGGTGACGCCCGCGAAGAGCTACAATCGTCAGGTGACGAGCAGTTCGAGGCACTTTCGTCAAAGTGAGCGAGTAGTTCTCTCTCCCTCTCTCTCGA
CTGGAATGTGATGGAGCGGGGCTCGCATGGCAACTAACCTCTTTCTTTCTCTCTCTCTCTGGTTGCACAAAGGAGCGAAGAAGAAGCCAAGGCGCTGGGT
CCACAGATGGTGTTCGTCACGCTTCGCGAGGATCGCGCCAACGCACTTGAGTTGCTTGGAGAGGTGGCGTCACGCTGGAAAGAGGTGAGTAATCGTAAGT
GAGCGTTCATTTGCGACGATCTGAGTGTGCTTATGCTCCTCTTCTTTGTTATGGTTGCTCGGCCAGTCGCTTTGGAATGGCGGTCTGGAGGTGACCGTGT
ACGAGATCGAGCAGGACAAGAAGCTGCTCGTGGGGCTCCAGCGAGGCGTCCAAGTGGCGGATCTGCGCCGCTTCTTGCTGGAGCAGCCCGAAGTGCTCGA
GTTTGAGTGGAACAGCCAGACGTACTCGCCTAGCAGCGATGGCGACCAGCGTCTGCACAAACAGCAAAAGAAAACAGCACGCTCGGGCGAGAAAAGCAAA
AAGCACCGGCCGAAATCGTCGCGCAAGAAGAGAGCTGGATACCAAACCAAAAGCACGGATGAAAACGCGAGCCAGAGAGATAAGATCAAGAAGAACACGA
AAGGCAAAACGCAGCGTACCAGTACACAACAAGAGCCAAAAAGCGAGCTCTAGACAAATGTATGAAAGTTCGATGGCACTAACGCATCGTGAACATCTTT
TTCTCTTCCTTCTTCAGTGCATTTTCCTCCCTGTGAGCGAGCAACTCAACGCGTTGTCTGGGACTTTGGTTCATTCATTCCACGTATATCTGGGTATGTT
TCTTTAACCACTGATGCGCTCGCTCTTGATCGCATCAAGCTGCGGCGCCAGCGACTTGTTCTTCTTGACGTTCTCGAAGAAGACGCTGAACTTTGGGTGC
GAGTCCGTGTCGCGCACGCTGCTGATCGCGTCCACCGCGCGTAAGGCGCTTCGAATGAGGTCCTTCGCGCGCTCCACCTCGGTGCCGACCTGGTCCTCCT
TGACCTTCTTGTTCGCAGTCTTCTCAAGCGGCTCCACCAGCAAATCCAACGCACCAACCACCGACCCAGGCTGCACGTGGCAGATCTTGACTAGGATCTG
GTGCGAGAGCATCTGAATGTCGTCCTGATCGCGAAGTCCCTGCTGCAGGTGCGGGAAGAACGACACAATGTCGAGCTGCTGCGGCAGCGTCTCAATCAGC
GTATCCACACACGAGTACGCAGCCTTGCGAATCGGAAGGCCGTCGTCCACCTTGTGCTTGAACGGACCGAGATCGACCGTGCGCTCGAGCTTGATCTCCG
TCGCGGCGAGAAGCGCTGGGAAGATCGGGTCCCGAACGTACGGGATCAAGAAGTGCGCATGGTGGTGCGCGCCAGTGTTGAGCGCCAACAGCGCCGCACG
ACGCACGTTCAAGTCTTCATCCTGAAGCGCCTTCAAGAACGGCACAATGTGGGAAAACAGCTTCTCAACAGCAGCGGTGTTTGCTGACGCCGTGAGCGCG
TACTTGAGGCTCGTAACACCAGTCCAGCGAGAGCCGACCGAGGCGGAGCCACACAGTTCAGTCACGACAGGGATCAGCTTGTCGCCGTTTGTGATGGAGA
GCTTGCCCAGGCACTCCGCAACCATATTGCGCACGCCTTCTTCCTCTCGCTCGCTCATCTTTTTCAGCACAGGAAGCACGCGGTCGACGTACACGGTGAA
TCCGTGCTGTGGACTCGCCGCGTGGTCAGAGATGACTTCACGCAGCGAGCTCAACAAGAGGTATGAGTTGCCTCCCTGTTCGAGCTTGTGCATGATCGTC
TCCAGGTACTCCTCCGTGTTGCCCACGCAGATACTGCCTAGCGCGTACGCTGCAGCCGCCTTCACTTCCTCGCCATTCGCAGAGAAGTTCTCCAGAATGG
TCTCCTTCACATCGGCGTATCCCTTTAGGTTGATCTGTCGTCCGAACTCTCCAAGGCTGTACAATGCCACGACCTTGTTCTCCTCCGAGTTCTGACTGGT
AATGTCGCCAACGAACTTCGAGAACGCGACCTGGCGGTTCGCCTCCGAGGTCACCACGCAGGTAGCAGCGATGCAGCGCGCCAAGTTGAGCACCGAGTGC
TTCGAAAGGTCGGATGGAGAGTCCATGAACGCGTTGAACAGATCCGTGAAGCTGCTGCCAGACAAGTTCAGCTCCGTAAGCTGAGCAAAGAATGCCTTCA
GCGCCTCCAAAGTCGGACCTTGAAGCATCGAACTGCGGCAGAGCGAAATTGAGTTCGCAAGTGCCTTCTGCAGCAAAGCATCGGTGGATGCAATCGTCGG
CGAGACACGAAGCGTGTTCGAAATCAACACGATTCCCGTGCGGCACAGCTGGAGATCGCTGTCTACCACGAGGTACGAGGCTTCCGAGACCACGTCCGAG
AGGAGTTCCTGCTTGATTTGAGTTCCTTTGTGAAGCACGAGGTTGTTCAGCGCATCCAGCGCGGCTTGCTTCAAAGTTCGCGACTGCTGGCGAAGAAGCT
GGGAGAGCGCGATGATGCAGTCCGACAGGATCGAAGACATATCGAGATCCAGCTTGGAGCGCGCAATCACAGCGATCGCTTTCATGCTCTGCACACGAGT
GATCTCGTTGTTGAGACGTTCCATCAGCAACGGGTAGACCTCACCGACACGGGAGCTCAATTCGTCACCTATTCATACACACATAATTAAGCAACTCAGA
TTGTTCAGGAGATAGGCAGAAGCATAGCAAGACGTAGACACGTACCAAGTTCCGCAACAATTTGCCCAATGCTGCTAATCGCAGACTCTTTGATCTCCTG
GTCGATATCATGCGCCTTCAAGCTTGGAAGCACGGCTTCGAACACTGGCACCGCGTGGCTCTTGGAAGCAGAGTCGTTGATCTCCGAAATCACGCGAACC
AACGATTCAATCAAACCCAGAGCCTTCGCCACAGTCTTGTACCAGTCACCCTTTGCACAGTGCACCGCAGCGTGGACAATTGCACCAATGTGCTGACGGA
AAGGCTCCGCTGGGTGGGTGTCGATGAGCAGTCGGAGGAACACAAGCGCATCCAGCTTCAAGTCCGAGTGCTTGTCTTCCGCAGCACGGAGGATGTTCGG
CAATAACACGTTGATGTAGTCGCTAAGCTGGCCACGTTCTACAGTTGCCAACTCGCTCAAGACCGCAATCACAGCACAGCGAGACGAGACCGACGCTTTC
GGTCCGAATTGCTTGTTTGCAGAGAGAATAATCACCTTGAGACGCGAGTGAACTTGCTCGAGGCACTTGCTCGACGAAGGTGTAGCAGAACCACCGTTTG
GAAGAGTACGGCGAGTTGCGCGGAGCAGCTCCGCAAAGACAGAGAAGACGTCAATGCGGACGTTTTCTTCACGTTCCTTGAATCGCGAAATGATCTGCTG
GCTGTAGTTTTCATACAGATGCTCCAGCAGCTCCGGACGGGTCGTGATGATAGCCGTGAGCACGCGAAGACCGGCACGACGCACTTTCCAGCTGGTATCG
TCGTCGTCACTGTAGTCACCATCGTCTTCATCCGAGTACTCTTCTTCGTCTTCATCCATTGTCTCATCTTCGTCTTCCGAGTCGCCGTAGTTGTAGTTTG
GATCGTACTTGATGAACTCCATCACCAGCGTCAGAATGCTTTGCACGTGGGGAGTGATCTCGTTGTGGCACCGAATGACAAACGACTCGAACGCCTGGAA
GCAGTTCTCCCGGAGCTCACTGGATGCCTCGTTTTGCAGAGATTCGTCGTCAGGTTCACCGCAAAACTTCAGCAGAATCGGGATAATTGCGCTCAAGTGT
TGCCCTAAGCGGTGGCCCGCAGTGCGCGAGAGCGTGCCGATGGTCTGGATAAATGTGCGCACATCCACCGAACCGCTTGACGCTTCAATACCCTTGATCA
GATGTTCCACAAGGCGAGTCAGCAACGCATCCGACGCCATCACACCAAGAGAGCCAACACACGCAGTTGCGCGCTTGCGCACGAGTGGCGACACATCGTT
CAGTTGCGTAATCAAGATGTTCATGATCGTGTCGTGCTCCGTCGCAATATCATGACCAAAGCGACGCAACAGGTCCGTCAAGATGTCAAGCGTCTCCGAC
TTCACTGCCTGGTCCTTGTCCTGCCCAAGACCTTTCAGCAGACGAGCGCACAGTCCTGACGCAATAGCAGCGCCAGTCTTCGTCGACACGTCCGTGAGGA
TTGTTTTCAACCCAATCGAGTAGATATCACGCAATTCGGGCTTGCCGTTCAAGATGAGATCGCTCAGCTTCGCGCAGATATCGGCCACCTGAGCTTCTTG
CACTTTCGTCACCAAAATGCCCAAACTGGATTGTAAACACAACACGGAGTATCAACATCGATCAGCTCTTGTTCTCACGGCGGACAGCACCACATTATAG
TTGCCCACAAAGTTGCGTACCATTTCACGGCGATCGACTGCACATCGTTCGACTTGTCGTCAAGCTGCTTCAGCACCGCAGCGCACACCCTGCGATAGTC
AACACATCACATTTCATACACCATACACTTAGAACGTCACTCCATCAAACTCCACCAGAGAGAAAGTGCATGGCACATACTTTGGCTCAAAGTACGGACC
CAGCTCCATGTCCTTGTTGAGCTCGTTACAGAGATCCGAGGTCGCCATGTAGCGCTCATCTTTGTCAAAGTCCGTAGTCTAAATACCAGCAGCATTACAC
ATACACACACAGACAAAGAGCATGACGTGTATCCAACACGGCAGGTTAGAAAGGCAGCCTGCAACCCAAAAGATCCTCAGCTCTACAGCGCGCGCTCCTG
TGACAACGCCGAGGCTCAGAGAGAGAAAAGAGGGAGAGAAGACGCATCGACAGTAGCGTTGTCCCAACACCACAAAGCG