Description :
From Genome Similarity Track
Location :
Scaffold_262:31016- 44566
Transcript NameFunction/comments
Phyta_totarag6367conserved hypothetical protein
Phyta_totarag6368hypothetical protein PHYSODRAFT_309120
Phyta_totarag6369hypothetical protein PHYSODRAFT_309120
Phyta_totarag6370hypothetical protein PHYSODRAFT_470556
Phyta_totarag6371hypothetical protein PHYSODRAFT_343759
Phyta_totarag6372endomembrane protein 70-like protein, putative

Sequence
13550 bases(100 bases per row)
ggtacacacTTACCGTTGTGGACAGTCGCGCCTGTCAACACCACGACCCGAAATTTGTTGCTGTCCGTCAGCGATCGGCAAAAACTGAACACTCCGCTCG
GCTCAGCGATGAGGGCGGACCATGATGTCGCCGATGAACATTGCATGCGGGCATGACGGGCGCCGCTAAATGGGCAACATGGCGTAACGGAGCTCGTTGC
CTGCAATGCCCCATGAAACTCCCCATGAAACGGTCTTATCTACATGGCTGCCAAGgtcttgtgcagcagcactagGAATGGAGTGGGCGTCGCCGTGTTC
TTTTTTGTGAGATCAACCTGTCGTGCGTGCGGCTATTCCCTATGCGTGACATCGTGGGACCTGCACCCGAACTCTGCCGCAGAGTCTGCGTGGTTGCCGC
TGTTGTCGTCTGCTCCACCGAGCCTCCGATCTCGAGCTCGGATTCACGATTTTCGACCGCAAGTGCAAGCTCCGGTTGCAACTGGCCGGTCGGTCGACAC
ATCCTGCGTTTTCCTTCTGCATCGAACTCAAAGCAGGCGGTGAATCTTGCGTGGAGGATTGGACGCCAATCTGGAGTGCTCTGGTCTCCGAtatgaatac
atgtaccataGTGCTGTAGCGCTCTGGTCTCCGAtatgaatacatgtaccataGTGCTGTAGCGCAGCACCCGGATTTTCATGTGCCTGCTGGTTCAGTT
TGCACCGCGCGCGGTTTCAGTAGGAAATGAGTAACATGCGCGTCctgcgctgcagttcgcCTGTCTGATCTAAAGAGCTGAACTAACGCCGTGTGTGCCC
GGCAACCGTGGCAACTTGTGTCAGCGCCGTAGGTGAGCCCGAGGCCCCACCCACCCCTGGCACTCGAAACCACAGACAAGCCCAGGTGGTTGCAAGCTTC
GCAGGCCTCGACGCTGGCGTAACTCTGTCGTGGGGACGCAAACGGGCCACGGCGTTCGACTCGCCGGTCGCATATCGGGTGACCCCATCCAGCCAGAGCG
CGGCGCCACACTATCCAGCGTCCGCACGTGCTGACTGCAGTCGGTATTTCCAGCCAACCACCTCACGTCACTCTCCGGAGGCGACGTACACAAACCTCGC
AGCTTGCAGTCTCCTGCTCTGCAAGTTGTACAATACGCCCGCACCTGCCCCTCGACGCCTGTCCAtaagaggaggaagaggaacCCTCAGCGAGGCAACG
AAAAACCAGTCGCCGAGCACTGTGCCATTTAACGTAGCGTAGCACAGGAAATCGGACGACCCCATCGACAACAAGCCAGCCACCATGAACGTGTTCCAGA
GCGGGGTGCAGGTGTTTATCCCGGCGGCGCTCAACCGACCCACGCACACGCTGTACAGCATCTGCATGCTGGTGCAGCCCACTAACCAGGAATGGACAGT
CAACCGCCGCTACTCgcagttcctgcagctgcgcaaggacATTCAGCACAAACTGGCCACGCGCGGCGTCTCATGCGCGAACTGCGCCAGCTTTAACCGC
GCCATCAGCAAGTTCCACTTCCCAGGCAAGTCCCTGCTGCGGGCCAACTCGGTGGTGCGTCACCGCGTCTCAGCCCTGCAAGAGtttctcaagctgctgg
tggggcGCGTGTACAATGATCTCCCCAAGTGCGGCATCTGCGGCGACGAGATTAAGGACATGATGCGGCCGTTCCTCATCCGAGGAGCACAGCCGATGAA
CGGTTCAATCATTTCCAAGATCAACAAGTCGCTGTCTTTGGATTCGTACGCCCCAGTGGACCAGCCGGTGGTGCCCGTCCCGGAACCGGCACCGCCTATT
TCGCCCTCGCTGGTAGGCAGGGAACTTTTCAGtgccagcaagtcgtcgagCAAGCCAATTTTCACACATAGTCAGATTTCAGGCGGCAAGTCcatcttct
cgcgcagcAAGGCGATGCTGAGTACCACATCGGACGATGCATCCACACAGCCGAACGAGTCGGAAGACCCCATCATGGACTACTCAGACAGCGATGAGGA
TGGCTACGgcaagaagtacgacgacCAGCGCTGCTACGATGAGGGCGTCCCTCTTGAAGACGCTATGAAGCAGGTGGTGTTGCCCGAAGGAGCTCGCCTT
ACATGTGAAGAGGTGGTTGCTCGGCTCACGTCCATGTGGGCCACGTACGACCTGGAGGAGGCACTTTCATCTTTACCACCCGAGCGGCTTTCAGAACAAG
CCAATTTCTCTGTAGACGAGAAGGAATACGCTTTTTAAGTGTTGGATAGTGCAATTTTGCTTTCCACCTCTAGGGGTAGCTGCTAGCCGGCCAGCAGAGC
CGCATCGCCCCATGGGCAGGGCGTTGTGCAAACTAAGTATGAAGCAGTCAGTATAATATCAATGCGATCAGCACACACACGGGTTACCACGGTTCTTAGC
CTCAATATTGCTGCTCatctggcagcagcacgcaaaCATGCTTACCAAAGTTGCTGGATTTCATTTTTTCCTATAGGTTTTGAACTCGACAGAGCTCACC
TCATGTTCGGCTTCTATAACTTTTCGGGGTCGGCGATGCCCGTGGCGACCACGGAAACACGCAGTTTACCGTCGAGTGAGTCATCAAATGTCGAACCGAA
GATAATGTTGGCGTGCGGGTCGTCAAGTTCCCGCGTCACACGctccgcagcttcgtcgacttcaaaCAACGTCAGGTCGGAGCCGCCAGTGATATTTACA
ATCATACCCTTGGCGTCCTGCCCGCCGCGAAAGAAACGTAAGACAACATTAATACGGCGTTCATTTGTAGAGGGCTATCAGTTACACGAAAAGAGATGAG
AGACTCGATGCATACCTTGATCGAAATATCTCCTAGAAGAGGATTCGCCAGCGCATCCTCCGCAGCGCGCAAAGCCCTACAAGGTGACCGCAAAGACAAG
CAACCTTTAGCAGATCCAATCTCGAACGCAGCTTGTCATCAACAGCCAGACGCACCGATTCTCTCCGTCAGCCTCTCCACTTCCCATCATGGCATTCCCC
ATGTTCTGCATCACCTGCAGTAACGAAAGGTAAACAAGTAATAAATGGGCAGTCAGCAATATTACCACCGAATGAAAATAAATAGAGCTGCGTACCGACT
GAACATCAGCAAAGTCGAGGTTAATAAGCCCAGGCATCACCATCAGATCAGAGATGTTCTTGACGCCGTCAAGGAGCACATTGTCCGCCATTCTAAGCAT
AAGCAAAGTGATAATCGTTAGAGTTGCACGACTTTATGTTGCGACCTACAAACCACATCCACGCGACGAAGCTTGAAAACCAAGTCACGCACCGGAATGC
ATCCATCAACGAAGTGCGCTCGTTCGACATATTGAAAAGATTCTGGTTCGGGATTACAAGCATCGTGTCCACGCTATCCTTCAGCTCAGCGAGACCTTGC
GCTGCAAGCTTCGCACGATTGTTGCCTTCAAAGCGAAACGGCTACGACGGGCAAGTAAATGAGGCTATAAGCGAGCACGGTATCAAGTTAACGATGTTGT
GGGTCGTATGTACCTTGGTGACCACGGCTACCGTGAGAATGCCAGCATCTAGGGCCGCCTGAGCAATGACGGGTGCTGCACCTGTTCCAGTGCCACCACC
CATGCCTGCAGTAACAAACATCTTCATAGACAAAGGCAAACGGAAGTGAGTAACCTCGTTGCCACCGCGTTGCACTTTTCAATCGCTTCAACACGAGTTG
CCAACACAACGAACCATGTTTGCACCCTGAACGCGTTCCAAAATCTCATCAATcgctgcctctgctgcttcacgacTGCATCAACACATCGAAAACGTGT
CAACGCGTAAGATACTCTAATCACCAAGAGCACACGACATGCAATCACTCACCCAACTTCGGGGTTGGCACCACAGCCCAGTCCTCCAGTCAGCTCAGGG
GCCATCTGAACGCGGTTCTCCGTCAGTGTTGTGCGTAAGTGCTGAGCGTCCGTGTTACAAACAAGGAACTCCACGCCTTGCAGGCCGCGCGCTATCATGT
TGTTCACTGCCAATCGATTCCAACGCGACAGATCGCAATCACTAATTGTTAAGTACATCACACCCGCTTTCTCACTCGACAATAAAGTCCACCCACCTGC
atttcctccagcacctccaacACCAATCACCACAATTTTTGGTGCGAAGCCCGACAAGTCCGTCACGGGGTGGTCCTGCGTGAGCCACAGCGGCTGCGTG
GAGCTCATCGCGGGCGgcacgagcttctgctccaccacAGGTGGCGGCACTGCGCTCACTTCCGTCGGTGACGCAGGttccgcttccgcttccacttcca
ctttcaacgcgtcgtcctcgtcctttCGAGACTTCTTGAAGCCCTACAGTGAGTTAGAGACGCGTGAACAATCAGTCGGACGCTGCATTTGGGCATTTGT
CATTAGGAATACAAGAGTTTTACCATGCGCAAcgcggcagctgcagcgtcagtTGCTTCAGTAGAGAAGGCAAAGCGCTGAGCAGCTACTTGGGAGGTCT
GGCGcgctcgcagcagcgccgtcgccgcgGCCTTCATGCGAGAAATCGCCATCGAAAAACTGGAGCTTGACGGTCAAGTTGACCGGATCGCCACAAATGA
TGAGCTACTTACACGAGGTGTTACTTATACGAGGGTATTTTATTTAGCTTtgaaatgtagccatctcgcTAGCTGTGCATTGGCTGTTGCTCTCGGTGGC
GCAGTTCCTCCACGTTGGCCTTGATGTATAGTAGCACTTCGGCTTCTGTCAGGTCCAACTGAACGCTGTAATTGCGCCCTACGAAGGTGCTGAAGGTATC
GACGTCTGAGCACAGAAGGCGGCCCGTGTCGGTCCAGATGGCCACGTCACTGATGACAAGGTTTGAAGAGGTAGGCAAATTGAAGCTGTCACAAGACACC
ACAAGTTAGAACGCAATACACGTTCAAATACACAGAGCGAAGTAGCATTATTACCCATGCAGGCGCATCAGTTCGGCAGCATCGTTGGGCCAGCGATCGG
TCTTGGATGGCAGCTTCGTCACTTGACAATCAGGCAAGGTTGCAGCCAGGATGTCTGCACAGGTTCCGTTAGAAACAAGAGTTGGACGATTGCTTAACAC
TAGCGAGCATATCTCTACTCGTACCAAGCAACCGATCGCAGATGGCATACTCTTCACTGCTCACTTGTCCAGCCAGAGTATAGTGCACCATGTTTTTAAG
ATGACAGAGGGTAAATGAGTGAGCGATCCATACACGCATTCAAAAACCTCTCACAAACGAAGACAACGAAGGGCTCAGAATAGAATAAATATGTTCTTAT
TATGCGGAAACGTCAAGGTCAAGCAGTAGAACGCGCACTAATGAAAGGAATTTCCAGAGCAACCACTCCAATGACGTAAGGTTTACCATCAGAGACTCTC
TGACAGAGAGAGCGTCACCTTCGACTTGAATATGTCTCTTATCGCAGATTTTCATTTGACTCTCAACACATCGAATACAAAGGACATTGACTTCAAAGAG
AAGAGAGGTTTCCAGGTGCTTTGCCTATTCCATCACGGAGCCTGCGAAAAAATACCGAGAGCTGACTGACGTGTGTCTGACCTTGCAGAACCTTTACCGA
AGTTTTGGTCGAACAAAGTTTTGTATTAACCCGATCACCAAACCAAGTGAGCACATGCTTTCTACAGAAGTGTATGTTCAAGCATGGATCGGAGGATTGA
TTCGTCGTAATCGTTTACTTCATTTCATGAATTTAAAGGTCATACCATTGAATGTTGCATTGAGCTTCAAGCTCACACCCTTCTTCACATTGCAGCATTA
TCCCGCGAAACAACGAACCAAGGATGAACCTCAAGTTACTGCGTGGTCGTCTTCCTTAGCGCTGTGGCTGCCACTCACTACCCTGACGTCGGTTGATGCA
CAGCAGTATTGCAACCAACAATACTGTAGCGACCCTCTCTCCGGTGCTGCGATGGCCAACGCTATTTCGACGTGCCCCTGCTGCCAATCCAGTTGCAGCA
CCGGTAATCCTTGCAGCTACTAAATGCGAGTGGACCAATGCCAACCAGAGTGACTTCGCTGCAAAAACTTCGACGAGACTGCGGCACCATGCTCCACAAT
CAATACAGAAATCTGTTTCGTGATCTTCCTCGTTTATAGTTCCTTCCAGAATCTCCCACGACGATTCtgtgcagcaccacgtcaACGCAAAGGGAGGCCC
ACGCATGCACTTAGTAGTACACAGACCTAAAGTAGCAAAGCTTGTCTTCGTACACGAACTCTACTGTTGCGCATTGGCGTTTCCGTTGGCATTCTCTCGA
CGCCTCTTGCCTTCTGCTCCAACTCGTTTAAACTTCTTGCTCTCCGTTTTGCTCTGGCCACGATACTTTTGCTTATCCCAGCGCGACATCTGCAAGGAAT
CTCGGCACCCAACGCCGCCTTCCCAATGGCGAGAGGTCGACTTTTTTGCTGCAACGTCGTTGCCACAGGAGCACACTTTGACCGAGCTTGATTGTTCCTT
CGAGCACAGACCGCAAATCATTCGACTAGCAAATTTTCCCAGGTTTGCTTTAGGACAGTCACTCGAGTCGTGGCAAACGTCGCACGGGAACGCTTTGCCA
CAGCATTGGAACCTAAACCAGCGCAGCGAGTGCTTGTAGTGGTCACACGTTCCATTACGAGGCAACGGCTGTCCCAAAATGAACACTTCCGCGACTTGCT
TGCCTCCtttcttgctgcttttgGCAACCTTTGCTAGAGTACCATCAGGCGAGTTACTTCGCTTCGCGCTTGTTCCCTCCAACTGCCCTGCCACGAAGCG
CTTTGTCGTCACAGCAAGCTTGACGTGACAAGAAAAGCAGGCTTGCTCTGATCGCTGCCTTGGCGTTATCCTCTCCAGCAATGCCTCACATCCGCACTCC
AAGCAAGTGGCCAACACATCAGTGGGGAGCACGTCAACAACGTGGCAATTCTCAGTGTCCACATAAGCTAGCACGTTGCTCTGCGAGTGGGCAAACACTG
CCCTCATTAGTACGTGATGAAGCACACTGCATCGAGGGCACCACTTCTGAATTATCGCAGAGTCCAAGCTCAGGATGGCGTCAAATTTTAACGGGCAGTT
ATCGCACTGAACTTGGCACACGAGCCGATGAGCAACAAGCGTGCCAACTTCGTGCAGAAACAGATCTTCGAGGCAGATTTGAGTGCCCTTCACTTCAGGT
TCGGTCTCAATAGTAACGCGCTTCTCAGCTGGAATGATCCTAGAGTCCTGGGCATGGTCCTCGTTTCCAGCTGACTCTTCCTCCCCCTGTTTCTCCTTTT
CAGAAATGGCGATGGGATCTACACCACGACGCACAAGTTCACACAGCGCCTTGAAGCGGTCGATGCACTCGTTCAGGGATCGACCATCGACCTCGTTCTC
TATGCAGGTCCATCGTTCCTTCTTGCCCATTGACGCCGGATACTTTTTCAAAGCCAAGTCaagtgctcgctgctgcgcttccgACCACTCGTTGTTGACT
TCGCTGTGTTTCTCCGTATTTTCAATGTTGCATCCTACTGAGTCGCGTCCCACCTTCGTATCTGGTTTGCTATTATCCATCAATTCGGTGGCATCTCCAG
TCGGAGCACCCAACTGCACGACAACAGGGCGAGGTGTGCGATCAGATTTTTGCTTCTGGTCCTTGTCCTTTGTTCCGGCATTCTTGAGCTCATGAGAGAA
CTTGCACTCGTCTCCGTCACGGCACTTATTCTGCGCGAAAAACTTGCACTTACGTACTCGagttttcttcttcttctttggtTCTGGTAGTAGTGCCACC
GGTTTTGACGTCTCAGATGGTTGTGCTGGGTCAGCTTCCCGGACAACTGACATTGCATCCACGTCCAGATCTTCAAGTACTTcgccactacatgtaatcc
CCATCTTCGACTGATCCTGCTTCATCCGGTGCGAAAACTTGCATTTCTCGCCATCTCTGCAGTTGCCTCTTGCGAAAAAGCGACAGGGTCGTTGGCCACG
TCTtctcttcggcttcttctcaCTCGAAGCAAGCACCTCCGCTTCAGCCACAGACGTCTCCAGCTCAGCACCACCGTCTGTCGCCACCTCTTGCTCCGTC
TCCGAGTCTTTCTCGAATGGTGCGATGATCGGCCAAAAGTTATTGTCGATCCAGGTCAGCAGCTTCCGGAGCGAGAAACCTCcgcgcagctgctgagcCC
GAGCGTTCACCGCGCCGTTCAACGCTTCAACCTGCTCTTCCGATAGTCGACTGCTCCACTGTGCGAAATTCACTTGGGCAGCTTCCATTGGGTATTTTCC
AGGCAGCGTCATCTGCAGTTCCACATGGCCCTTGAGTCGCGTCGGCAGCTCCGGATCCGACAGACTCAAGAAGAGACGCACGCGCTTGTTCTGCGTCGTG
GCATCCTCACTGCTCAACTGCAGGTGGTAGCGGCACTCCAGCGCCATCCactccttcttggcggcgtCCGTTTCGCtcgccagcgtctcctgCCAGCTCG
GGTCCGCCATCGTTGACAACTTCAGGCAAGTTCGAAAATGGCTAAGATTATCAATGCGAGTATTCATGATATCGCGAATATATGATTGGTGGAACGGCGA
ATATTCACCTTACCAGACGGATTGTTCCCAGAGACTTCGATCGAGTGCCAAGAATTCATTCAACGGGTCATGACCATGTGGAACGTGCTTCTGCGCGGGC
CCCGCGGCAAGCAGGTGGTGCTGAAGATTGACCCGGACGCCAACTTCAATACGTTCTCGGGTCCGTAGACTacatgatgctgctgttggtctCGACGTTG
TGCTTGTTTTCTGATCATTTTGTCCTTTAGAACTCGCTGCCAAGGAATTGGGTCTGAAAGCTAAAGATCGACCGACCTGTACGTACCCTAGGTTCTTGTG
CTTCGCTGCAACGGTGGCGCCTTATTTGCTGTGGTATACTACAGTTCGTAGAGGATTTCCGCCTCGAGCGGTCGAAGTGGACGGCTCAGCGCTCGTCAAG
TACGTCTTCGAGGCCAACGACactgtggtggtggacacgagctctggcgctgcagctccagttcaaGCTCCTGCTTCTACCGTGAAGAAGGCTGCGGCAA
AACCAAAGCGAGCGGATGCAAATAAGACAGCGGCGAAAGCGCCGAGAGGTAGAGTGCACACGCTGAATCCGCCGACTAGCTCAAAGAAGGCACCGCCGAA
ACGAAAAATCACAGGCAGTGGACAACAGCTTGGTAACTCGCTGGAGAGTAAcccatctgctgctgcaggggCTGCAAGTGCAGGCGATAATGGAGACGAA
CCACAACGCAAATACAGACGCAGTCGTGCGATTAACCTCACGTCGAAAGAGGATGTGGAGATCAGTCTGGTGAACGCTGTGAGCGGCCAATCCCACGATC
GTGCAGCAAAGTTTTTCCgtgcggcgacgaagaaCGCAGTGGAGCATCAATATGAATTGACGCTGGCCACTGCTAGGCTGAATGCAGCATTGGCACATAA
TTTTGAGATTGAAGAGCTATCGACTACCCGACGTGCTGATGGTAGTGCTGCCAAACTGCGTGTGCGCTTCAAGGAGACACCGCGCAAATGGAAAGAGGAG
ACAGTGGATCTACTAAAGACagacgagctgcaggccatTTTGAAATATGTGTTGCTGTCAGGTGGCGAGACTGGGCGTGAGATGCTGAAGCCGTTTAACA
TGGCGCAAGTGTCCATCAGAGTATTTTGGAGTATCGCGCGTATGTACGATGGagatgtggctgctggtcTGGCGGACCTTGTGCCTGATGAAGATTGGTC
GTTCTTAGACACTCGTACCCGGTACGTTCTGTTGCATTCTTTATGCATCTCATGGTCTGGATTTGACGTGTCATGCTGGCTCATGACAGAGTTATGTCCG
AGAAGGCTATAGAAGCGAAGGTATGTTAACCTATTTCTTGGTTATGCTCTAGGTTTTTTAGTAACATGTGCCTTGCCTCTGCTTTTGTCTTCAAATCTAG
GCAAATGAAGAGCAGTACGCCTTGTGGAAGCAAGGTCATACCCGGGGAGGCGATACGTCTTCTCCGAAGCCAGAGAGTAAGCAGGAGGCAAAGGCAACCA
AACGCTCCGCagccaaggagaagaagcctGAGGTGATTGAAATTGACTTGAGTATTGAGGAAGAGGTCAAGCAAGCGGTTGCGGAACCAAAGCGTGAACC
AGCGACTCAGACACCAGCTCTTTCAGCGAAGGAAGCGACCCCCAGCACCCTGCGTAGTGCAGCGGCACGGGCTGCGCTAGCTCGGTTCGACCGAAGTTCG
CAAACAAGCGCCATTGTAGCTGCTTTTCTTCAAGAGAATAAATCAGCTACTCAGTCCGCCAAGAAACAAGTGGCAtccgacgatgaagaggaaaCGGAGT
CCGAGGAAGAGGTGGAGGAAGCTACTACAGTTTACTGCGATTCTTGCAAAAAGGCACGTATCCTTTCTCCCGAGGAAGCTGCTAACGCTGATCTCGATAA
GGATCCATGGACCTGCGCCAACTTGGCGAAAACTGGACGCAGTGGTGGTTGCGACAGTATCGATGATGAAGTGGCTCAGATCACGGGCGCTTCCATTGCT
GAATGGCTGCGAAAGGCTGCCATCACCACTCGACGAGAATTAGCGGACGCTTCTGTGGGTTCCACGATGCACGCTCATGTGAATCCATCAGACCTGTCAG
CTCTGACTTTGCAGGAAAAGCTTGAAAATCTGATCGACGAGGTGAGTGAACCTGCGGTAAGCTGTGTTGTCGACGACACTTGACTAATTGTGCGTGTAAA
TGAATGTGGGGGTGAATGAATGATAGGCGCGTCTTGATGAGGTGAACGACTGGATGTCGGAACTTGTTGGCGAGGCTGATGTGGTGCAACGACTGGAGGT
TCAGAAGCTGGGCACACCTGCCGATCTGATTGCCACACCGAGCGATTTGATACTTGAAGCTGTGGGTAGCACTGCTGAAGTTTCTATCGATGTGATAGTC
TCCTGGCAAACTCACGCTCAGAGGTTGGTGGACAAGCACCCCTGGTTGGCAGAATGGCGGACGCTGTAATAGCCTGGAATTAGTTTGGTTGATACGGATT
TCTGTTGGTGCAGCTCACGCTGCTTGATGTCCAAGTTATTGAAATCGAAATGAAATTTATTTTTCTTCCGCTTTCAGCTTTTCTGTCTTCTACACATAGC
AGGAGGCGACAAACGGCACGTGCATGGATCGAATATGACGCATTATTGGGGCTGCCACTCGTTCGCTCCTCGTGGTCGCTCCACACTTCTGCCAGCCAGC
GTATCGCCTCCGTCCTTCCGATTCGCCGCCCGTCACCTACCGCCATCGCACATTGTAATGCCATCTCATGACCAGAGTCGTAACTTGCTAACTTGCTGAC
TACTTAGTCGATCTTAATGGAGCTGTAGATCTTGCGCGTAAACCAGAGGCAAGCAAAGTAACCGATGGTTCCCGTGAGAAAGAAGAACGTAACCGAGATC
AGGAACATGTAGCCGAAGTACAGAATACCCGAAACGAACGCCGTGATGTTCAGCTTCGTGAAAAAGTACAGGAACGAGTAGAGGAACAGATACACGGCCG
CAGAGCCCGAGGTGAGGAACgaacgccaccaccagcggtAGTCCTCAGCGCAAAGTTGGAAGTAGCACATCACGACCGTCACCTCCGCGCACGTGGCCAC
CAGAATCAGCAGCAcaatgaagaggaagccgaACACGTAGTAAATCTGGTGCAACCACAGCGCCGACATGATGAAAAACAGCTCAATGAACACGGCGCCG
AACGGCAGGATGCCGCCCACCAGGATGCTGAAAGGCGAAGACAGGTACCACACTTGCTCCGGGATCTGACGCGCAATCTGGTTCGTGCGCACAGGCTGCT
CAATGGCAGCAGCCTTGAAGCCAAAGTAGCTGCCGAGGAAAACCAGCGGCACAGAAATACCGAACCACAGGACGAGCAGAGCGAAAAGCGTACCGAACGG
GACAGCCTGCGATGAAGACTTGCTCCACAGCACCAGGTTCAGCAGGAAGAACACAACGAACAGCAGACCCGGGTACAGCACGGCCGTGAGGATAGTGTTC
TTTTTCCAGTCCTTGCCGTTGAACATCTTGTACGTACGCGACGAGTGGTAGCCAGCAAAGCTGCCCATGAATAcgaagagcaacagcaacgtcgtAAGCA
GCGAACCGCGGTTGGCCGGCGACAGCAGACCCAGCAGCGCAATAATCATCGTGGAAGCGCTCATGGAGCACACCTGCACACCCGTGCCCACAACCACCGA
GAAAAGCATGGGCGAAAGCTGCGGTGGACGGAACACATCGCCGTGGACAAGCTTCCAGCCAGACTCTTCCTGGGCCTCCTCCGTGGTCTGCACCTCGTTG
TAGCGAGCGATGTCACGGTGAAGCGTGCGCAGCATGATCATAGCAATCATACCCGTCAGGAACAGCACGATCATAAGCGAGTTGATAATGGAGAACCAGT
GGATCTGGTCATTcgagcttttgctgctgataaTGCGGTCCCAACGCTCCTCCCAGACGATGTCCGATTTGACGAATTGCACGTCGTACGTGTAGAGCAC
GGTGGTCTCGCCCTCCGGGTTCAGGTACTGGTAGTTGCCCTGGGACACCTCCTCAATGTTGACAAACTTGCCGCACGTGTCCGAGTCCAGTTCCTGCCCG
GCCATGGGATCATTCTCGTAGCTGTGCTTGATGGAGGTGGGCACGACttcgaagccgacgacgcgCCACTTGGGgacgtcgccgtcctcctccgcgTACG
GGTCCGCGTTGACGGAGACGATGATGCGCACGTGGTTGTACAGAAGATACttgccgtcctcgtccacttcGCCCACAGGGAAGCCGCGCTTGAAAGATCC
AGCCTGCTGCGAGTCCGTCGGGTCGCGGTACAGCACGGGCAGGTTGTCCACCACCCACTGCACGTAGTACTCGTCCTTGATCATGTCGATGAAGGCCTGT
GACTGCTCGGACGTGTACGTCATGGGCTTACACAGCACCTGGCAGATCGCATCCTTTTCCATCTGCATGTTGTAGAGCGAGTCCATGATGGCGTCGCCAG
CCATGATCTCGCCCAggttctcctgctgctcgttggTGGCCGTGGGCTTGCAGTACGGCAGGTAGTAGTACTCGTACGGCACCAGCGTTTTGGTAGACGT
GATCTTGTTCACGTTGAGGCGCACGGCGTCGCCCGCGGCCCAGGACTCCGGCGCCACGCCCGGCACGTAGAAAGCTGCGCTGgcctcctgcaccaccagG
AGCGCggccagcgccgtcgccgccacgCTCTTCATCCACATTGTTGACTGCTTGGAAGGGGGAGAAGggagagagggggggggggttagctgcgctgctg
ctcttgctgctgctgccgtccgTCGTCTGGCTTCTTCGCGGTTTCGTGGGCGAATGAGGGACTTTGAGCCGCCACGAAGCCGACGTCCGAGAACACATAC
CTGTGAAAAGAAATAGATGAATAGGAGAAAAATGACCTGCGGAAATATAT