Description :
From Genome Similarity Track
Location :
Scaffold_14:31015- 34747
Transcript NameFunction/comments
Physo_321343Hypothetical protein
Physo_290724conserved unknown protein
Physo_308798Hypothetical protein

Sequence
3732 bases(100 bases per row)
CCTTTTTCGGAGCAACGTTCACATAGCGCTTGCGGAAGGCCCAAAGCGTTGCCAGGAAGAAGACAATCATCACAAAGCCGATGACGTACACGCTGAAGTA
GCCATACTCGGCGGGGATGGCGCCGACTCCGTGGATGGAGACGTAAGGAAACACTCCGAAGCCGATCAATGCACCGACGCTGGCGACCGCGTACTGGATG
CTGAAAAAGAGGGACTTTTCGGTTGGAGGAGCGGTGGGCGAGAATTGATCGCCATCGTACGAGACCACGAGCGACCGAAGGCAGACTTGGGAAATGGCGA
CACCGAAGAACAAACCGATGTTGAAGATGATCTTGCTCGCACCGACGTGGTTTAGAACAGCTGGCAGTGCAGCAATAACGATGAGTAGAAGGCCAAAGCA
ATCGAGTGTGGCAGCCGACAGCAGAGTCTTGAACTTGCCGAGGCGTTCGTCCGAGATGTACCCGGCCACAATGCACATGAACTGGCAGAGCGAGTCGTAG
GTCAACTTGATCGATGTGGAGCCCTTGTTGGACCAACCCAACTTCACGAAAAAGTTTTTGAGTGACTGGGAGATGGCGAAGTTCGCGACTTGACTGAAGA
CCGTGAGGATGAACAGAATGATGCAGACGTTCTTGAGCACATGTTTGGCGTACTTTGCCGGTCGTTCATCCCAGAGCTTGGTGCTCACGTAACCCGTGAC
GGAGGGTGTCAACTGCGGCGTGAGAATCGGAGATGGAGAAACTTGCTTGGACATCTGCGCAGTTGAAGGCGAGTTCGGAAATGAACAATAAGCACGTGGT
CGGCTACTTGGCGGCAGTCTCCACTAAGGTCACCGCGTACCTTGCAGAGTCTACAGGGAGGGATGTTGGAGACCAAGCGTATTTGCGTACGTACAATGTA
GTGTCTACCGGCGCAAGTCCTATCTTCATGAACAAGTACGGAGCCCGTATTTGTGCATATAGAGGACACTGATGGACCCTTGGCAACGCACGCAGCGACC
CCGTAACGTCATTTAAAAATATTGCTTTTAATCCCACGTTTCGCCGTGAGGAAATGTTATTGGTGCCTGTGAACCTCGTCACAGAGATACTTGCATGGGC
ATTGCCCGGGACACGGTTAAAAATGAATTGCCCCGGCTGCGGGTACCGCACTGCGGTCTGACTCAGACTCTGAGCCGCTTCGCGCTCCTGATTGCGTTGA
ATCATTTGTCGTGCAAACACTGTACGTTGTGGGTGTTGCGTTGAATCATGTGAAGTGAAATGGGCTTAGCTGCGTTATCCGAAGTAAGATTGTCCCCTGC
ACGCCTCTCACGAGATGCGTAGGAACTGAGCGCAACTTGCACCGGACGCTGTCCAAGCCCCTATCGGATAGCGGTAATCGCTAAAGTAAGCTTGGTAAAT
CGCGACGATCACCACAATAGCAAGGCGTCAGATACTTAAATACAGTCTAAAGAACGCTGCGAATTGTATATCATTCCGCCATTCTTGTTTGGTACCCGAG
CAATCGTCCTGTCCAATTCTTTTTGCTGCAACATTGGTGGTGGAACAATCACTCACTGTACCCCACCGACATGTTCGCTTCCGACTGAAGACTGAACAGC
GAGCACCCTAGTCAGCGCAATGCAGGCAATATAGCAGGTGGTCTCAGCTGCTCTGCGTAAAACTGTATACCGGTAAAGAGCCCCGCTTGCGGGGATCCGC
TCGGCTAATCAAGCAAATAATTGCATGAACGGCAGCATTTTGCACACGATATCCGGTCAAAGTTTGACTCAAACGGCCTTGTACGGGCCCACAGTGAAAT
GCCCCGCAAACCGAGGCTTCTTGAGTACCATCGACCGAGCAAGTAGCACAAGACCATAAGAAAATCTTGCCCATTGACATGTGAAATCGCAGAGTGCCCA
TTTTCATTCTGTCCAGTTCCAAAGTGCTCGAATGCTAGCCTTGTATTAAGTACGAATGAACCTGCAAAATGGTACAGTTGTGGTGACGCCCCTTCCAAAC
AGCCTTGGATTCAGTATGGGGACTTCCCACGCCTCCCGTCCTCCCCCTCCTTCATTTCAGAGGCCACCGCTGCTCTTGCATCCCGGCGGTCTAGTATTTT
GCCGAGTGTGTCGGGGCTTGCGACCAGAGATCCAGACATGTACGCCGCTCAGCTCCGTTCCAAGGACGAGATCCTGGCCATCCGCGCCGCCGAGCGCGAG
TACGCCAAGCGCGTGCAGCTCGCGCAGGAGACGCTCAAGGTCGTGCGCGAGGAGCTGGCCACGTGCTACCGCGAGAACGGCGTGAACCACAAGATGGCGT
GCAAGGGCCTCCGCGACGAGTACGCCAAGCTCATCCAGGACCCCACCCACGGCGCTGGCTACCCGGTAGGTCATATACAAAGGAGTGGCGCTACGTTGCC
AGGGGTACGAGAGGAGAGAGAGGGAGAGACGCATGACTTACCGTATTTTATGTATGTTGGATGGCTGTGCAGACGCGACCGGAGTTCTAGACGCTGGATG
GATACAGGACGAGCAGATTAAAGCGATATGTGGTCGGGAGCACAGCAGACACGGCCTGGAAAAGGAAAACATGACAGAAAAATGATGAAAATACATGCGA
ACGAGAATCGCTGGTTGGTCATTGTCTGAAGGTAATGTTGGGCCTGCTCGTGGACTGACAGAGTGATAGCTGCTGTTCCTTTTTCACTGCTACTAGATGG
AGTGCTGCACACCCTCAACGAGTGTGCTGGTAGCTGCGTCGCTTACAGCGGAGGGACTGAATCCGCTCGAGAGCGTGATGGAGGCCGCTTGAATCGACCT
CTTCCTCCTGCCACACAGTGTTTTCAACTTGGTTGCGCGATGAGAATTGAGCTCGAATGCGCGGGGGAGAGTCATCAATCGAAGGAGTGGAAGAGTACCG
AGCAGGCTTCCTTCCGGCAACGTCGCATCGGAATGGACTTCGCCTTCGCTTTCCGGTAGCTCGTCCAGAGCCGGAGGAGGATTCAGCCAATTTTACTCCG
GGTATACCTTCTTCGGGACAATTGCAGGACGATGCCACCACAGTCGACAGCACCGCCTCGTGATTGGATCTGCCTTCTTCCAGTACGCGAGAGATTCTGT
CCGAGCACGATTTCACACTAGCTTCGACTGTTTCGATCCTGGCCTGAAGCTCTGTAAGGGCTGTTTTGACCGCAGCTGCTTCGGTAGCCACTGCCTTTCG
GGTTTCCTCGCATGCTTCATTGTTCTCGAGATTCTGTAAGCATTTTCCAAGCATGGTGAGTTGATATCAATCCAGCGAGATCAACACGGCTAACAAATTG
GAAACCTGCTTGCGGAGATCGGTCACGGCTACAACAACCCCCTTGACGTCGTCGGATAGCTTCCCAAGGCTGCATCGTTGTTTCTTCAGGTCGTCGCTGC
TGGTCGCGAGCTTATCCTTGATTTCTTCAACCGATTCGTTGATCGGCTTTGCGAGCCGCTCCATCGACACTTGCTGCTGTTGCTTCTGCTGGTCCGTTTG
CTCAGTGAGTGCCTTCGTGAGGTTCTTTTCTAACTCCTGCAGCTTCTCGCTAAGGTTGCAGTGGGCAGGAGGCGGAGGAACCGGGGGTAGCGCGTGTTGA
GCTTGCCACTGCTGAAGACGTTGCAGCTGCAGCCAACACAACGCCGTCAGAGCAGCAAGAGCAAATATGCAAGCACAGGGTTCACCCTCTCACTTGGTCA
TCCTGACTCGACCCCAGCAAGTTCTGTGACTG