Description :
From Genome Similarity Track
Location :
Scaffold_2767:3101- 4170
Sequence
1069 bases(100 bases per row)
GTGAGCGCCAGGAACATAACGGCGTTGGGCTTCGAATATGGGATAACGGAAACTCACCTTGCGCGTGCGTCTCACGGGCCGCCAGAAGCGAGCCGGCCGC
CACGGCGACAAGCGCCACGCGTGACCAGATCATCAGATTGACTTTCTTGCTTTGCGGGAGATAAGTACCAACAAACGATGTTCGCTGGTAAGTTGGAAGC
CGGGTTTTTCCTTCCTCTACAGAAATGGGGAGAACGTAGAGTGCGGGTCAAGTTACCTGTCCGAAACGCTGGACTGAACTCTGGAATCCCAGCAGTTGGG
GCTCCGGATGGACGCGTCTGGAAGTGGATATGACCTTGACCTGCTTGGGAGCCCCAATGGGAGACTCCCAACCCCTTGGGAGAGCCAGCACGATCAGGCC
CAAACGGCTTTTTTGTGTAATAGGGCAGAGGGAAGGTTGTTGGATTGCAGTGTGAGGCTTTTGGCCATTTTTCACAGAACGATCGTTCCTTTGAGAGGAA
AGTCCCAAACTTCAAAATTATATTCATGTGCCAAAATTAGTTTTCAAACGCCAGACGCAAAATACACTGCAAGACGAAGCAAATTGGAGGCGNNNNNNNN
NNTCATGTGCCAAAATTAGTTCTCGAACGTCAGACGCAAAATACACTGAAGACGAAGCAAATTGGAGGCGTAAAAGTGGCCTGACCTCAATATTACCTGT
AAAATACAAATAAATTGAACGCAAACTCGCCTCTTGGCATTCAAGTGACGCCTGGCAACCACGTAGTTCTACCACAACCCTCGTCAAAGCCAGGGCGATG
AATCAATTGCTAGAGGTTTTCATGGTCCATGTTGCCGCGATCAGCATCAGGGCCAATCGCAAAGAAGGTTGTTGGGGATGCTCAGATGATGCTATCGATC
GATCTCTCCTGGAGCGAAAAGTATGAAGCCATTGGCGCAAGCACAAGTCACCCTCGCGAATGGGTCCGCAGTCAGAATGGCAGGTTGATAGATCTCGAAG
CAACATAATAATCAATAACACTATTGTACTACCAGCCAGCTAAGTCAGTAGCACTGTACAAGATGAAGA