Description :
From Genome Similarity Track
Location :
Scaffold_413:310- 2874
Transcript NameFunction/comments
g16993.t1XP_009521616.1 hypothetical protein PHYSODRAFT_327246 [Phytophthora sojae

Sequence
2564 bases(100 bases per row)
CGGACTTCTTGTACTCGTCCAAGTGGCCCAGCAGACGGTACTTGCTCATGTATACGAACAGGCGCGGAATGGCCACCTCCGTGATATTGCCCACGAATAG
GCGAGAGCAGAACACAATGGCGAGCATGTACTCCAGCTCGTGCATGCAACTCACATCGCACCCTTCGAAGCCCTCCTTCAGGAACGCCACGTAGAAGAGA
CCTGCGTAGTTGTTAACGAACTGGAAAATCACAGTCTTGACAATGAGACTGTTCTCGTACTCCATGTCCGTGCGATGGTTCTCCTGATCCACGAGCAAAA
CGGAAACGTAATTGTAGATCTTGGTCATGATAGTGATCTGCACAACGTTTGCAAGAGAGGACACAATCGATCCGTACTTGTAGTCGTCCAGCACCAGCTT
GTCGGAGTCGTTGCCTTTGGTCAGGTCGTATGTCAACATGAAAATCGATGACACAAGCACAAAGACGATGAGGATGAGGAAGGAGATGACGACCCAACTG
TAGGCCACACGCTTGAGCTTCTCGCGTGGAGGGTAGAATCGTGTGGACTTGCCATTGATGGGCGAAGGGATGCGCTCACCGTAGAACTGCGGACGAGGAT
TCACCGTCTCCGAAAAGTGTGCGGTGCCCCAGCGAAGCGTTTCTCGTGAGTTGAGTCGTTTCCAGTTCTCGAGATAAATGGTCATCCAGACGGTCATGAA
GGCACCAAAGATCGGCGAGATATACGCGAACACGGTGTTGTAGTCGTCATGAGGGATGGAGTAGCTCACGACGCCCGTCACGATGCCCACCAGTGTCGGG
TACAGCAGCCATTTGGTGTAATGTCCCAGATACAAGAAGTAGAGCGCCACCTTGACGCCAAAGTACTGGCAGATGCGGTCAAAGGGCTGGTTCATCGGGG
ACTTGTTCCACACGATCCATTTTTCCTTGAGGTTCATCTTCTCCTCCTCTTCGTGCAACGGGTAGGTCTCGACGATGATTTCTTCGTAGATCAGTCGGTC
GATGTCCTGACCAGCTCCTGTCTGGTGGTTGGTGATAATGTGCTCGATGAGGCTGATTCGGTCGGTGCTCGAAAACAGCGAGCCCTTCTTGGTGTAAAAG
GGCTGCAAGTCTCGGGCCTGGAAGTACGGCGCGAAGATGTAGTCAAACGGCGAGTACCTGTACGTCTGCTTCACGTCCCGGATCGGGAACGGCGCAATGC
CGTACTCGGGGATGCCGTTGAACGAGGCCCGGCGCAGCTCGGCCGGGTCCAGCTGAAGGTGCATCTTGAGGTACTCGGCCTCGCGCCGCATGAGCTCCTC
AGGCGCGCGGATCTTGCAGAACACGAGTTCCTTGCCGACGGAGTAGAAGAGGCGGAGGCGCAGGCCGGCGCCGCGCAGGCGGTTGATGATGGTGTCGCGC
TCGTCGCTCACCTCGATCACATGCTTGGGCGGGTTGGGAAACACGATCACGTAGTCCCAGCGGCCTGACGTCTCCGTCGTGGACGTGCCGTAGTCCAGCG
GCACGCGCAGACGCACCTCGGCGGTCTGCGGCTGCGGGTATGGGTCCGTCATTTGAAATTGGGCCAGCCTCGTGTGGTGTGGCGTAAATCGTTTTAAATA
ATTTAATTCCTGATTTTTTTTTCGGGGGGGATTCCCAATCTCCTACAAGTAACGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAA
ACCCAGGACCAAGCAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACATACGGGAACCACGTGAGACGAGCGC
AGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAG
CCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAA
ACCCAGGACCAAGCAGTGCATGGTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTGTGGTACAAGTCTACTGTAAAATATACTGAT
ATAAAACATAAGCCTGTCATAGTAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACGCGG
GCGGCGCTCGGCTAGTCTCCTACAAGTAACAGAGTAACCTGTCCGTCTGTCCGTCATTCCGTACGCACCTCGAGGGTAACGCAAATCCGGACTTTCCGTT
GGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCCTCCCATTCGCCAATACTATAATTCGAGCCCTCTCATTGGCTATATAGTGGAGACTCTGCGCGA
TTGGCTGTTATAATGCGTAGTGTGGACTACACCACATCGGAAGTAGCCGAATAAAATCACTGATGCTGATTGGACAAAATAAACCGCCTTTAACAACGTT
TCTTTTCATTCCCATACGTGGTCGAGTTTCAGGGAGATTCCAGGCAAATTCTGCAGGTGGTGAA