Description :
From Genome Similarity Track
Location :
Scaffold_1462:310- 2164
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh-pir_contig_1462-abinit-gene-0.13Polyprotein
Pytir_DAOMBR486maker-pir_contig_1462-fgenesh-gene-0.0Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_1462-snap-gene-0.1Polyprotein
Pytir_DAOMBR486maker-pir_contig_1462-snap-gene-0.2Polyprotein

Sequence
1854 bases(100 bases per row)
GCTTCCTCAAGGCAGAGTGTACGCAAGTGACGCGGATTTCACCCCGTCACACCTGGTAGCACTTCGTAGTCCGTCCAACGACCACGATCACGATGAGCGC
CCCCCGATCGTGATCGACGACGGCGAGCAAGCGCTGAACCACAGCGACTTCTCGCACCTGACGGTGTTCGAGTGGGAGGCGCTGCGGCGCCTGACCGACG
TCTCCGGCATCACGACCGTCACGGCGATGCTCTCCGCCGCTTCCGCCGCTCAGCAGCGAACAGCGGTGCACGAGTTCCTGGCGCGCGAACTCGCCGACTC
GCGTCGGCGGGCCTCAACTCCCCCGCTGCCCAAGAACGACGCAGTCAAGCTCGACGTGCCGAGCTACAACGGCGAAGGCCCCACCGGCTAGCGCTCAACC
GGTGGCTCTGCGAGGTGGNNNNNNNNNNTGCGAACGGCGGTGCACGAGTTCCTGGCGCACGAACTCGCCGACTCGCGTCGGCGTGCCTCAACTCCTCCGC
TGCCCAAGAATGACGCAGTCAAGCTTGACGTGTCGAGCTACAACAGCGAAGGCCTCCACCGGCTGGCGCTCAACCGGTGGCTCACACGAAGTGGACATCG
CCATTCAAGCTCGCCAGCTGTCGGCCGAGCTGGCGAAGAAGCACTTCCTCCTGTCCAAGCTCACGGGCAGGGCGAAAGAGTGAGCGCTCGGGCGACTCGT
CGCCGACCCGACCTGCTTCCCGACGACGGACGCTCTGAAGAACGACCTGCGGCTCGCGTTCGAACCGCCNNNNNNNNNNTGCAGCGTTCTTGACACTGCG
ACAAGGCCGTTTGTCGATGCACGACTACATCCAGCGCACCCGACACCTCGTCTCGTGTGTCGTCAAGTCCCCGATCGGCATGGTGACGCAGGCCCACGTG
TTCACCGCGGGCATGAACGCCGGGCACCAGCGCTTNNNNNNNNNNCGCAGCGTTCCTGACGCTGCGACAAGGCCGTTTGTCGATACGCGACTACATCCAG
CGCGCCCGACACCTCGTCTCTTGTGTCGTCAAGTCTCCGATCGACATGGTGACGCAGGTCCACGTGTTCACCACGGGCATGAACGCCGGGCACCAGCGCT
TNNNNNNNNNNACACGGTGATGCAGGTCCACGTGTTCATCGCGGGCATGAACGCCGGGCGTCGGCGCTTCTACCTCACGCGCAAGCCCCCGACGTCGCTT
GATGAGGCCTTCGCCGTCGCGCTCCGCGAGGACTTCAGCGTCATGGCCGCTCGCGGNNNNNNNNNNTGACATCGCTTGAAGAGGCCTTCGCGGTCGCACT
CCGCGAGGACTTTAGCGTCATGGCCGCTCGCGGTCCCCGCGCGCAGGAGCAACGCGCGGAGACTGAGCCGGAGCCCATGGAGGTCGACGCGATTGAGCAC
ACCACGCAGGGGCGCGGTGTGGGTAACACGCGTCCGCGCCCGGCGACGAACAAGCAGATCAAGTGTTTCCGCTGCGGCAAGATCGGTCATCGAGCAGCGG
TGTGTCGCGCACCAGCTCCGGTCCTCGCCGCTGTCGACACCAGTGGTGACCAGCTTGACGACGAGCCGCGTCCAAAAAAACGCGGGCCACGAGTAGGCGC
GGGGCGCCCTACTTCGCNNNNNNNNNNAGAGGCCATCGCGGTCGCACTCCGCAAGGACTTCAGCGTCATGGCCGCTCGCGGNNNNNNNNNNTCCAAAAAA
TGCGGGGCGCCCTACTTCGCGGACCGATCGGAACGTGCCTCCAGTGGCGACAAGTCTCAGCAGCCCCTCTGCACTGCACACGCAGCTGCACGCCACCACC
TCATGCAGCGACTAGCGGCTGATCGTACTCAGTCTGCACATCGCCGGCGCCAAG