Description :
From Genome Similarity Track
Location :
Scaffold_2342:310- 1960
Sequence
1650 bases(100 bases per row)
AGAACCCAGAGGGCTCTGGAACTAAATCCCCATAGCACGGCTACCTACTTGCAGGATAAAATCCCGCAAGTTATAAGCTACCCCCTAAGCAGCCCCAGGA
ACCTCGGACTATCTGTGTATGTGTGTCTTGCTAGCTACTAATGCAAACTAACATGTATACACGCAGCGTACCTTGAGTAACGTGGCGTTCCGCGGCTTCC
GTTTTGAAAATGGGGGCAAAATGAAATTTGAACTGTGCATTTTAAGTACGATGTGTAGACCACATATGATATGTACACCACATATTGCAATTTTAGCGAA
TCGAGGCCGCCTTCGCTGCGCTCGGCAGCCAGTAGAACGCCCGCATTTGCGTTACATGAATTAGCCCTAGCCGCGGACGGACGTACGGACGGACAGACAA
CACACTCCACTAGAGGGGTAAGATGTGCAGTGTTTCTCTCTACAACGAGGGAAACCTTATTGGAATGGATTGGGCGTGGGTTCCTGTTGTCAGCGACAGA
TACTTGAATCTACATGACTAGCAAACCCACATCAAACATTTTGAGTAATGCCAAGTCTGGAAATCTTGATCAATTGTGCCTCGCTCATGCAATTCTCTCA
TTTTCTAAATACCGGTAAGAAATGCTGGGGTTACGAGGGTTACAATGTAGCCAACATACCCTTTCATAAAAAAATCTTTTTCAACCAATCACTGCACGCG
GGACTTTTCATACTGGACACCAGCCATTATCTGACCTCATGGCAGGCAAGAGGAAGCGCGATGCTTTTTCGGCACACGATAAGCTGGTGCACGCGCTGTC
ATTGCCACGGCAGATAAGCGCGGTTTACGACGGCCACCCAAAGCCCCCAGGACGTTTAACACTCGAGCATTCGAGACAGCTCATCGCACCCCGGGAACAG
GGTGGTTCCACGACAAGTTTCGGTGTGACAAGAAGTCTTTCCTACGTATCTACCGGTTAGTGCACGCAGCGTGGGGCCGTGAGCCCGTCCCCAACACCAA
GCCCCCGTCATTAAGCGCGTGGCGCTCACGATACTCTACCTGGCCAAGGGTGGCACCATGGACCAGGCTGCAACGGCGCTGGGCATCTCCAGGCCTCGTG
GTGTAGTCTACATTAACGATGCTCTGGACGTGCTCAGCGCCATGGCGAAATCTATTATCTCCATGCCGCCAGCAGAGGAGCTAAAAGCTGTTTAAGATGG
CTTCTACGCTACGGCCGGGTTTCTTGACACCATTGGCGCCGTCGACGGTACTCTCGTCCGTATTGCGCGCCCACACGACTTTGAAGGCTGGTACTGTCGC
AAGAATTTCCCTGCAAAGTAAATGTGCAAGCTATCGTAGACCACCGTGGTCTGTTCCGGTCCATTTCCATTCGATCGGGGTCAAACAATGACCAATCGCT
CTGTAATGGATCGGGGCTGAAAAAAAGATAAGGTTCAGGCATTTTATTGTCAACAATAAATCTAATTTTGATTGATGCATTTGTAGGATTTCTAGCTACG
TGCCCCCTGGAAAGCATTTGCTGGCGGATGCCGGCTACAAGATCTGGGGTCATATGTTGACCCCGTTTCCGGAGGCAGACGCTATGCAAGATCCTCGAAA
GAGGCGATACAATAAGGCTCATTCCAGGACTCGAATCGTCGTAGAGTGCA