Description :
From Genome Similarity Track
Location :
Scaffold_680:31- 5772
Sequence
5741 bases(100 bases per row)
GCTAGTCATAGTCTGTGACCGTGACTGATGACCCCTTAACTTTCCACCGTACCGTTGGAAAGTCAGTCCCAAAGCCGGGGTGACCTGTCTCACATGTATC
CAAGATGTAAAAGATGCGATTGGTCAGGATTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCA
TATAACCCCTCCCCATTGCCATATCTCATGATCATAGTCATTTTCGCTCTTGAAACAGATGATCACCACCGCTCGAAGTCGATGTTGGCACTTTTGGTCA
CCCCAGCACCTCCTGAACTCGGCTTCTTGCACTTGCATCACTTCAAGCCAAATCTTATAGCATGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTTTTTTTGATCGTGTTATCTCCTCACCTTGATCACCTGATCATTGCACGCTGGTGTCAATATTTC
TTCTAGTCGGTTGAAGGTAATCAGATCCTGACGAACTTAATCGGAAAATGTATCCATGCCTTTTTCAAGCTGTANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATCACCACAAACGACCACTCTTCCCCTTATCTGCTTCGCCAAAAGTTCATAGCCCAACACC
CGTTATACTCTGCCTCGTTCACGGGCAATCCAGTACAGAAATGCGATGCGGCCTACAGTATCGTCCGCTCGGGCAGTTTCCGTATCACTGCGCTGTAAGC
GCCCCCTTTTTTTCTTAGTACGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTGTAATACTCGTCGCGAGGGTTCCGATGATTTCATCTTCCCCTTTATC
ACACCAAGTAATCTCCAACATCCAAGTCGACAGTAAAGCAGCCTACCTTTCAAGTCTCCCGTTGAGACCCGATGATTGCATNNNNNNNNNNCCAAAGTTG
AGTACCGCGTGAGCACCTTAGTGTCCCGCGATATCAGTAGCGTATAGCAAATATCNNNNNNNNNNGCAACTAAGGACTTTGCCATGTCTGACCGTAGGGG
GAGGAATGCTTATGAGTTGTCGCGGTCGCTTCCGCGGTGCGATTGCGATCAACATCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCT
TCTCCACCATATTGTAGCTGATTTCATACAGTTTTAACGTCCAAATATGTGAACATAACAGGCCAATTCACTCCATNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAAGCTGCGGATTACCGCCCATTCGATAGCCTAAACCACTATCACTAGTCGGCGATCCGGGTCAAAATGCCTGAGCACCG
GGGTTTGAGCTAGTTTAGCTTTCAACATAGTGAACGCGATCATGGCTTTTCCCAACGATGGCCACCAGTATATTCGCCATTGGACCCTTCAGTTTTAGGG
TGATCATGACCATTCATCGTTACCAGCTGGTGATCATGATCACCCGCAGGCATCTACCCGTGGTCATCATCGATCTGGGTACTATGGTCGTGGTTATGGC
TGGCTTCGCCATCATTCTCCATGTTGTGCAAACACATAATTTTGTGGAAATCAGCTTCCGTCAATTCGTACAAGACGAAAGAATATATGGCAAAATCTTC
AATGATCCAGCTGTAGTAATTCAGGCTTTCTAAGTAGGACTGCATTGACCGCAATGTTTGGGGAAAATGAATATTTAACAACAACCTTAATTCCTTCGGG
TCGGCTTCTATTCCCGATGTTGACACTTAATGCCCGAGATACTCGACCTTGCGTCATCCCCAAACACTCTTAGGTAAGCAGATCGACAAATTACACTGAT
CNNNNNNNNNNTGGTGCCCGATATACTCGATCTTGCGTCGTCCTCAAACGCTCTTCGGTAAGCTGATCGACAAATTCCACTCATCACATACTTCCAACAA
CCTGTTCACCTTTAGATAGTGAGACGTCCAATATGACGCCGGGGTTAGAATGTCATCAATGTAGGACNNNNNNNNNNCGAAGGATTTCAGTGCGGGTTTT
GCTCGCCGTCTGTAAAATCACATCAACTGGTTGAGACACCCTGTGGTCACTGACTTCCACCGATCCCCGATCGTGAGATACCCGTATAATGCATTATCCA
CCATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGTAGATACACAGTCGTATAACCACCCCATTATTTTTCACAATCACTAA
GATCGGCGACGCCCACGGTGAAGTTGAGGGACATATGATTTTAGCCAAAAGAACCCTTTGATCAGCTCCGCCAACTTTTCACGGANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTTTTACGACATCTATGTTGCAGATGGCGCCTCGTGCGGCAGGTGGTGGTATGTTTCC
TTTACCGATCAGAAGGTGTCGTTTCTTCCAGATCAGTCTTCTAGCTCCTTCGTCAATGGTGCACCTGGGTTCGCCCACCTGTATGTCGTCAATTTTTACN
NNNNNNNNNNNNNNNNNNNNAAGACTGCCATAGGTTGTACAACATCCTCTGCAAACAACACTACACCCTCATGATGATAAGACAAGCGTTCGCTTGCTCC
TTCGCTAGCGACCTTTGTCATTTGGCTAGCCTGTTGGTCGGACGGTCGATGTACATCACAATCCTTACTAGTGATCACGTCTGGGGGCTGGGTGGACCGG
TCTTGCGTACGATCAGGTACCATCTCACTGATCGGCTCGGGAGTGAGTTCTTCCTTACATCGTTTGACTGTGTTTCTGACTGGTCCTGCACCATCTTGAC
GTCCTAAATCACGTCGGGAGAAGTGTTCATGTCGACTAACAGTGGCAATCGCAACGATATTCCTCTCTCGGTTTCACTCTTTTGCTCCAGATGATCAGAC
ATCCGATCCCAAACCCTATCACCGTCATCCCCTTCACTAGCCTATCAGATGTGGTGATCACGTTAATAACCACCGGCGGTTGTCCTGACTGCGTTCTTTC
AAGATTATCTTGTTTATCCACGTGATCCCATATCGGCCTATCACCTTTTAACTTTGCTTTCTCTTCATCCATGGTCGTCTCTGATATATCCTTTGGCTGT
CGTTTTACAATACGCGTTGTTGGCGTCGGATATGACAGGTGTTCAACCAACGGTCCATCTACTTCAGGCAATTTTTTCTTCGTCTTCTTTCGTGGTCGCT
TAAAACGCAAGTCTCTGCCACTTCTGATATCGCCGTGACCCCACGGACACAAAACCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCTGGATGATCACCTCCTAATCAGTCAGATTGGTCAAGCGAAGGTAAGTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCAAGGTAGGCTTCTACTCAGTTACCCAACGGGATCGCCAAGTACTTCTCATCCGCGGCAATTCGT
TGTATCTTCGCTTCATACGGTGGCCTTCTACCTTACAGTTGAATTCTGACTCCGTCCACAAAATAAACTGTCCCTTCCGCCAGGTCAAGGCGTATCCCAG
CCGGTACCATAATATCCATTCCTAGCATTGCTTCTTGTACCACTTTGTTACTAACCCATACATTAAAGTAGTAGACTAGTGANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTACCCACAAATTCCTGCTTCAGACTTTTACCTATGCCTCAGCCAACCTTACGAGCAAAGGTGGTGTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGCTTCGTCTCCTGAGTCAAACAAGAGGGTGTTCAGCTCACTGTTGATTTCCCCCTGCCTTGGCTTGTCTG
AAACACTTGTTTGAAGTATGATAATTCCAGAAAATACGTAATTCACCGGGAACAACTTAGGTTACATCTTGGTAGGTGATCGTGCGTCGTCATCCGGTCT
TCGCAGAATCGCAATTGAAGGTAAACAACTAGAATCCAACTCATGTATAATGAAAGTCCGACCGGTCAGGCAATGGACACTTTCATCAGCCCCTTCTCTC
TCAATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAAACTTTTTCATCGAGCATTTGACTCCTTTGTGTACTTCTCCA
CACGCTGCGCACCNNNNNAAACATTTGCCAGAGGAATGAACTTGACGTCCGCTCTTCTGGCACGTCAATCGTTTCCAGCATTTCCTATCATCAGGTATTG
TCGACCCACAATGAGTGCACGACTTGTATCCCACTGCACGATCCTGCTCCCGCTCCCGCTCACAATCACCCAATCTTGTCTTGGTCCGACGTTAATTTGT
TCGATCCGTCGTTTGATCGGCTGTCGTANNNNNNNNNNCTGAAAACACGTTGTTGCTTTTCTTCTTTGTCCGAACCGATTATATCTAATTTCGATGAACT
GCCATCTCCCCCCACGTGGATTGCACGCACATCCCGGGCCAGTTTAGATAGACTTGGGGTATATGGCAAGGCTGATCCCTGAGAGGAACCTGCTTGGGCT
GGTCGGAAGGTTGCCTTTACGCTTCTGCGTAAGCTCGTTTGTGCGGATCATTTTCTCCAATATATCCACGTCTTCCGATCGCAGCATCGTTATTTTTTCC
ACGAGGTCGCGATCGTCCAGTATTCCACATGGTCACGGCTA