Description :
From Genome Similarity Track
Location :
Scaffold_2868:31- 2470
Transcript NameFunction/comments
Phypl_g15448hypothetical protein PHYSODRAFT_325775

Sequence
2439 bases(100 bases per row)
ACTGGCGGATCAAGTTGTAGAACTACTCTATCGGGCACTTGTCGGCATCGTGCAGTTCACCACAGGCACGGCACATGAAGAGGCAATGATCCGACGGATG
ACCCTTCCTACCGCACTTCTCGCAAGTCAgtctcttccagcagttcaAGTCGTCATGCTTGCTGGATCCGCAGTGGGAACATGGCTTCGACGGGAAGTCC
GGGTCCGATCGATCCTGCGGTCCCGCCGCGCCTGGGCGTGGTGGCTGCCAGTTGCCTTGATCCTGACGATCGGCCTTCGCGGCGAGGTAGATCGGGCGCA
GATCGCCTTCTGGTTCCGATCCGCTGGCttccgactcggactcgtTGAGGCCTTCCTTCGATCGTATCGCTCGAGCCGCGCGGGCAGGTTTCGAGGGAGC
CGGATGCGTTGGAGGTGCAGCCTTCTGGCGGAACTTGCTCAATCCGATCGCTGCCTTTCCTTGGTGGGTCTTGGCGCGCTGGCGTGAATGCAGCGTATTT
TCGAGATGGCCCGCTTCGGCGATCATCAGTAGCGCCAGCTGATCCGCCAGATCACGATCGTCCAATGTTTCAATGAAGTGTTCGACGTGTTCCCGGCGAG
CGTCCGGCGATCCATCCTTGATCGGGAGTTTCGCTCGCATTCCAGCAACGTTCAGTCGGTGGAGATACTCGAGCGGTGATTCCTCGGATCGCTTCCTCGC
GTGATAGTACTGTCTCGCAACAGACACTCCACGTCCGCAATACTGGATCAGGAAATCCTCCAGCAgactcttccagctgcttcgCGTCGTCCGACTCAGC
TGACGGTACCAGTTGCGGGCTGGTCCCGTGAGCAGATCGCCGAAGACCAAGCACTTCTCGCTGTCTGGAGCCTGACCACGGATTAACGCCGACTTGACTT
TGCCGAGCCAACTCCTGGTGCGatcttcgtcgttgtcctTCCCCGAGAACTCATTAAGTTCCGAGATCGCGGACACTCGGATTCGTgcggccgacgtggc
gccCCCAATCGTTGCTTCTGTGGTCGCCACCACAGCACGTCGAGGCCTGCCGATACTCAAGTCATCCGGATCGTATTCGTCCGCCGGAGATGGATCATGA
TCCAATCCGACCGACATCATCTCAACGTCTGGCGCATCGCTCGGTCTTGGCTTCTCGGGCGACTTTGGCGTCTCACGGGGCGGTGGCATCcgctcctgca
gctcacgtggtggtggcatcTCGGCCCCTTGCTGTTCCTTCAAGAATCGAGACTTCGCAGCGTTGAGGAACGTCTGCATGCGATCTGGCGAGTTCTGGCC
CGAGGCAGGcttcgcctccttcttccgAGCTTCCAGCATGGCGGTGCCAGCCAGTCCCAGCGCCATCCGCTTCACCTCAATCGAACTGTTTGATCCAGCA
TCCGACGTGGTCGACGCGTACTGCGAGGATCCGCTGCGCTGTGCCACCATCGTTGCAGCCGGTGTGGCTTCTCCGACTAGAGCAGCCAGCTTCTTAAAGA
GAgcgagcgtcgtcttcgtggtcGCGGCCAGTTCCAGATCGAACAACTCGTTCGCGTCGAACGCTCCTGGCACGATCCCAGCTTCCTTCAGCATGCGCAT
CAGGAGCttcaccgcgtccagcttATTGAGCACTTCCCTGGGTGCGGTTACAGGTCCTCGAAGATCCCCGATCAGCTTCAGACGCATGATCTTCAGAACC
GGATCCTCGACCAGCAACGCGTACAGTCCTTTTCGGTAGAAGACTGCTTCCTGCTGATCGTCGGTCCAGTCCTCAAGCCCAGTGCGATCTTCAGAGTCGG
ACTCCGGGGCCAATCCCTGGCTCAGCCTTGATCTTGACATCTTCTTCGGTGGACTCACGGTGAAATCCAGAGTCACCAGAAgatccgggcacgcgcacca
ttgtggcggagcaggaatCGCGAATTTGCTAACACGATCCAAGCTAGCCAACGGTTGCCCAGACTACCAACTTACAgagggggtactccgttCGTCCGTG
GGGGCTGAAGtcttctcaccttgtgtacccgttggttgggcgggttacgctcttccggtgacggcgaagacgtctGTGCGATCTTGAGTTGAGTTTGTGT
GGACGGTACTTGGGGGATTGTTGGTGACAGCTgcgtggaaatcttcactTGGCTGTCGAGTGTAACCGACCAGGGTCTTGGATGTGCCTTGGTCCACTCG
TGGGGGTGTCCTTGGGGGTTCCTTTCCGTGCGTGCCGCTTCCTGTTGGCGGGATCTTTGAGTGgagagaaggtggaggcCTGGCCAAGCAATCCAGGtgt
cttcggcgtcttctccgtgagGGACTTGGtgccgtcttggtcgtcgggaGGGCTAATATACTTCCCAGCCCGGAATCCAAAGGCACTTGTGTCTTACAAG
GAAAATCTTTCACTGTTATGTACCTTACCTCCTTCCTAT