Description :
From Genome Similarity Track
Location :
Scaffold_1696:31- 2097
Sequence
2066 bases(100 bases per row)
AATGAGGACCCACAGTGGGGCCCATGGTTAAGGTCGTGTTCGTACAAAGTATCTGAGATTTCTAGCATTCGTCTCCCATGTTTTCGGCGGAGTGCTAGAA
ACAATGATACATTCATGCAGATCCCGAATCCACCGACAGATGAAATGATCCACAGGAACTCGGTTGGGAGCTTCATAGGAAAACGGCGAACCAGGTTGGT
GGCAGTCAAAGATCTTATTCGTCTGGCTACGGGAGTCAGGCATTGTAGCTTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAG
TATTCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCGTCGCCGAGGATCAGCCAAGCTGC
GTCCTCAAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCG
CGGGCGAGGATCCGAGGACAGGAAGTCCCTGTGAACGTGAAAGCTCGGGATCCAGTACGCCCTACGCGCGATCTGACACAATCCAGCCAGGATCGAGCCA
GATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGGTAATCGCCTCACGGATCCAGTCCCGCCAATGGACCAGACGGCCACAGGCTCTTC
CGACACTTCCTCGGGCACCCTGCAGCGGCACTTTGAAGCTGCGATGAATCGCTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTG
CTCCACGAACATGGAGCACGGGACGTGGAGATGGAGTCAGTAGAGGGGGACAACTCCCATGATGAGTTCGACCCAGACGATCTGGATGGCCCATCCACTT
CGGCAGCCGTGGTAGCAACGGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGACTTGAAGGAGTTTACGGG
CAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTT
GCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCAACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGT
ACTGTGGATTGGGAGTGTCGGTGGCACGACGATACTACCACGCTCGCCCGCAGATCGGATGAATCCCCGCTGAAATACCTACATCGACTAAATGTGGCCG
GTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAAGTACTGCGGGAACACGTGGATCACTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGA
CAGGCTGACCCTGTTACGTCTTTCAGACGCAGATGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGA
TCCGGCAAGTATCGCCATAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGACGCCCGACTCAGGAACTGAATCAGGATCCGACG
GTTCGGACTCCGACCCTGAAGATTACCGTCGGGTCTGTCTCACTGCATCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCGACCGGGGGATACCGT
ACCCGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCACAGTGCGGATCCCGGAAGCACGTCAGCAGTGGTA
GCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATG
AGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGC
GGGGCCAGCTAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCT