Description :
From Genome Similarity Track
Location :
Scaffold_807:31- 1607
Sequence
1576 bases(100 bases per row)
AGCTTCATGATCGAAGATACTTTTGGCCACGTAAGTACTGCATTCTGTCCCGATTAGTTGGTGATCAATTCGTGACTTTGCCAAATGGTAAGTGATCAGT
TGGTGTAGTTGGGGACTCATTAGTGACTATAACAATTGCTATGCTTTGGTTAGTGATTAACACATCTTGCGTCGTGGTTCTTTCATGATAGGGTCAATAT
GTTCAACATGCATTGGTCGAAAACGAGTGTCATGCGTGCATGAAAGATGCTATCTGTAACGGGCCTAGAGTGTCCGTTACTAGCTTACACGTAATAATGA
GGAAACGTGCAAGTTCCGCGATAGTGAAACCAAGTGCTTAGTCTGAAGGAAAATCAACTCTGTTTTTATTTAGGTCCAGGGCAGCTTGCCCTGACCACTC
AAATACACGTCAAACCCTTATTGGGTGATAATGGGTCTGGCTCCCCATATATCAACCAATAGGATGACGGCAGTTCAGCACACGCTAGCCGTGTGCTGCT
GCACCTACTTTTGTAATATAAATCTACCTACTTATGTAATGGGCGTGGCCCACTACATCACCCCCCTCTTAAAGTTGCACTTACGCAACATAAGCGACGG
GCGGGGAACAAATCAATCAAAAGGGAAACAAGAAGAAAATCGTGACCAACAGGAACGAACGAGGCGGGGACGAGACAGATCCTGCGCCACGCAGGAGAAG
TACAACACGACTTGCACAGCAGACAACAGGAGCGGACGATGGAACAGCAACAGCAGCAGATTCCAGCGACGGCGACGTCGCTGACGAGCGCGACGACCGC
GGCACGCGGCACCCACGTGATGAACGAGGCGCTGAGACCCTGGGCCCTGTATGATATCTCCGGAGCGCAAGATCCGGAGTCTCTGGACGAGATGAAGGAC
CTCATCCGGCGTTTTCGTGCGCTGCGCCAGAAGCCGGTGGACGGCGTCGACCACAGTGCGCTACAGGAGTCGTGGTGCGCCATCATCCGGCGCTGGAACC
GGACGCAAGCGCAGGAAGAGAATCTCGTCGACTGGATCGCATACCGGGAAGAAATCATCGGGGGCCATTCCTTGGGCGAGCTGCGCGTACGAATCTGCGA
CAGCGCTTGGAACGCCGACGACCGCATCTGCTACGTGCGAGTTGCTGAAGGCTGCAGAAGGTGTGTGTCGTCTCGCCCGACTACGGACGAGTGGAGAGCC
CATGTCGCCGAGCATCCGCTCAGTGATCGCGAGAATGCCTGGATCGAGCGTTACCGGCGCTCGCTGTCCGAAAAGGCCAGCGCCGCTAGTCGCGCCGGCT
CGCGCCGACACTCATCTTGACGAAGCGCATCTCCGCCGCTCCGTTGGGATTACGAGATCTCGGGTCGTCGTTCTCGGTCGCGCTCGCGCGATCGCCAGCA
GCGTCGTTCTCGATCACGCTCGCGTGGTCGTGCAGACTGGAGATCCCGTTCTCGGCCGCCGCGTGATTATTCGCGGCGCTCTCCGGCGCAGGAAGACTGG
AGTCGTACTCTTGGATCACATCCGGGACATCGCGAAGAAGATTCGCGCGGGGCTCCCACGTATCTTGGTCCGCCGG