Description :
From Genome Similarity Track
Location :
Scaffold_3417:31- 1319
Sequence
1288 bases(100 bases per row)
GCGGTGCATATACTCGCGGGTAGTCGAACTCAGACAACTGATGCCACAATAGGTTATCGTTGTAGCTGAACCGGGCAAGCTTTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGACGACACTCGTCGTCGCCGGGGTAAATGGACTGGATTGTCTCCTTCATGTGCATGAGGTCAGGAATTGACTC
GAGACATGTGCGATCTGGATGCGTCCAAGCTGTGTCCTCGCAGTCTGGACGGCGCGAAAGCGCGTCCGCGAGGGTTCACTCTCCCAGGCTTGTATTCAAC
TCTGAGATTGAATTCAGAGGAGAACGCCAGCCATCGCGCCATGCGCTGCGATAGATGGGGAGAGTTGATCGCAGTCCGCAAGGGCGCGTGGTTGGTGAAC
ACGACAAATGGAGCCACACCCAGAAGGTGGATTCGGAATTTTAGAAGAGCATACTTGATGGAAAGTAGCTCCTCGTCGTGAACTGGGTAGTTCTTCTCAG
CTGCTTTGAGCAGTCTACTTTGGTACGATATGACGCGGTTTCGACCGCTGTCATCAACTTGCGTCAGTGCGCTGCCGATGGCAAAGTCGCTCGCATCGCA
GACGACACTGAAGGGTTTCATGTGGTCTGGCAAAGCCAAGACCGGTGTAGAGATGAGCGGCTGCTTCACTTCATTGAGGGAAGCCGCAACCTCGGGTGTC
CAGCTCCGCTCGACATCCTATTTCAAGAGATATGTAAGGGGGCGGACCTTTGCAGCATAGTCATCACTGTACTGGTGCAAATAGTTTACCAAGCCGAGTC
GCTTGCGCAAGTCCTTGGCATTGCGCGGCACTGGCCATTCCGAGATTGACTTGATTTTCTCTGGGTCCGCACGGACACCATCGGCGCTGGCAAAGCAGCC
AAGGATCGGATCTCTGCGGCCTCGAAGACGCACTTCTTCAGGTTGCAATACAGACTGTTCTCCCGCAGGCACTAAAGCATTGCGGTGAGGTGTCACTTGT
GCACCTCAGTTGCGCTGAGATCTCCTTCGGTATGACTGTGCACGAATATTTCGTCAAAATAGCTCGGCGCATACGCGCGATGCGGCCGGAGAAGGTGCGT
CACCAGACGATTGAAGGTCGCTGGTGCATTGCGCAAGCCTTGCCGCATGACGAGCCATTCCCATAGCATTCTGCTGGGTGTGCTGACGGCCGTCAGAGGG
ATATCCTCCTATCGCATCAAGATTTGATAAAACCTATCCATCAAACCGAGCGCGGAGAACACACTCGACCCACCCATGGAGTNNNNNN