Description :
From Genome Similarity Track
Location :
Scaffold_152:30997- 35605
Sequence
4608 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCGTCCAAGGACCACAAAATCCGTTCAACATGAACATGTTGGACGATGAAGGCGACGACACCTTTCACGGCA
CCCGTTAAAGTTACTCTTATTTGAGTGATGTCGAATTGAGTGCGGTCGAACAAATGAGCTCGACCGTTGTCGAAGAAGCTGTCTGGTCTCTGCTATCCTG
AAGGGATTGGACCAACAACATTCCATAATTGCCAAGTCATTCAACGAGAACTTGACGCTTCGCAAGCTGAAGTGACCCTGCTGCATCATGACGCCACCAG
CAGACTGAGCTCCTGAGACAGCAACAGTCTCAGTCTGCTACTGCAGCGTCGACACGTGAGCGTCGACGCGATACTCTAAAGTTAGAAGTCTCCGAGTACT
GGGGAGTTGAGGAAGACTCCCTGTTGAGATGGTTCCTCGAAGTGGAAGATGCCATTAAGGCTCGCCACATCGACGAAGAGGAAATGCAAGTTGCTTGCCA
AGTCGAATTTGTCAGGGCGTGCCAGAACTTGGGCCCTGAATCTTCAATTACACGATCCAAACGTGTTTGAATCGTTGGCGGTATTTAAGACTCTGCTCAG
CCAAACGTTTGAGCCACCAAGAGCTGAGTTCAGGACTCTAACAGAGCTCCTGAAAATAAAACAAGGAAAGCGTGACGTTCACGCTTACGCTCAGCGCGTT
CGTTACCTTGCAAGTTGCATGGTAGCGAACCCTGTAAGTGAATTCGTGTTAATTACGATATTCTTACAGGGCCTTATAGATGGTCCCGTGAGGAACCACC
TATTCCGCATTGAGTTGAAGTCGCTTGAGGAAGCGATCACAACTGCGGTGCAAGAGGACTTTATTGTGAGACAAGCTCACACTAGATTGACCCCCTATCG
TCCTGCGAGACGAGTAGAGGCGGGAGGTCCAGAATCAATGGACCTCTGTAGTGTTGAGAGCGAGAGACCTCGCTCTTCAAGCAGTAAGAGATTGCTAAAT
TGCAATCGCTGTCAGAAGTTAGGACACTACGCCTACGAGTGTAGTGCTTCACGCCCAGTGTCTCAAAACACTGAGCGAAGTGATCGACCGTCTGCCAAGA
AGGTCAACGGACGCGGGTCCAACGCTATTGCGAAGTCACAACAGCGTAGCGGACCATAAAAAAACGGTCGAGGTCAGTAGGTGCGGAGCGCCCTACTGAT
CCAGCAAATGCAATAGAATTTGCAAATCTATTGATGAAAGTTGCTCCAGACTCACAATCCTTGTGTCTCTATGCACTTGGTGATGAGGTACCCCCCCCAT
CACCTTGAATTTAAAAGTGACAAAAGGTTTGTCACTTCGTACCTTAGTTGACTGTGGGGCGTCGAACAACTTTGTTCGTCGCCAGTCACTAGAGGATCCT
AGGCTCAAGTTCGTTGAGCGCGTTACTCCTCCTACGAGGCTGACGGTGCGCCTCGCAACAGGCACATCTATATCAGTGATGAAACGTGTAGTGGAATTTC
ACTACACGTTAGAAGATTTGCAGTACAATGATGATTTCATCGTACTTGATTTGGATTACAAATTTGATGTCATCCTGGGGTTACCCTGGATCACAAGGTA
CAAGCCAAGGGTCAGCTGGCAGCATCGAACCGTGAAGATGCCTGCCACGTGTTTATCAGATGTCCATCTGATAAACGTCTTGGAGCGTCCACAAGCGTGT
GGATGTACTGCGAGTGAGTGCGATGCCTCACTTGCGGTACGGTCGTTAGTACGACTGCACAAGATCACAGTGTGACAACCAATCACACTGTGGAGGAAAC
TGCCGGCGGCTGTGCGGATGCACAGGCAGCGCCGAAGGTCCACCACTCGAATAAGTCGAGTGGATCGGTACATGGGTGTACGCCTGGCGGGCGACATCCA
AGTAAGAATAAAACGGTTGCCCACACAGGGCAACACGATGATCCTAGATCGGCTGGAGAGTCGATCGTAGAGGATATAGCTGTGGTAGCGCAACCACAGC
TAGAAGGCATCGAGGGAATAAGCCCCCAGCAGTCTGTGGAAAAGGGTTTATAGGAAGAAACTGATACATTGAATGTCTTGGTTAATGACGGGTCAAGTGT
AGGCGCTTATACAATTGATCTGATCGCACCTCCGAAGTCGACTTCGGAGATCACTCAATTGCCAACGCTAGAACCGAAACGGTTCTTGCGAGATCTGCGT
AGTGGCAAGATCAAGAAGATCTGTGTACTCGCCATGGAGGACGAGTTCGTGACTGACATTCGGTCGGCAGTATTATTTGCAGAGGACGAACGGGTTCTCA
GCAGCTCATCAATGGACAAAAGCGTCCTCGATGAGAAGACTCGGATTGAGAGATACACGTCTCAATATTGGGAGTTGCTTCAGGCAAATCCTTTATATAA
GGATTTGATCGAATTCAAGGACGTGTTCCCTGAATCCGTACCATGCGAATTGCCTAAGGATATAGGCACTCGACATGAAATCGAGCTCAAACCGGGCTCG
AAGTACTGTTTCATGAAGTAGTGGCCACTGCCTCGTGAACAAGTATTTGCGATCGACAAGTTCTTTGCCGACCGCTTAGCTGCGGGTCATATGAGGGAGT
CAACTTTCCGTCACATCTCTCCAACCTTCTGTGTGCGCAAGGCCACAGGAGAATGGAGGATAGTGCACGCGTTCAACAAGTTGAATGCTGCAACGGTACT
GGCTCAGACGCCGATACCGAGGAAGGACGTAATCATTGATGGTATGTCGAAGAGTACCATCTTTTCGTCCATGGATCTGATGGATGGCTTCTATCAGATC
CTCATGCGTGAACGGGACATCCCGTTCACAGCAGTGAGCACCCCCAGCGGTATGCTGTGGGAGTGGCTAGTGATGCAACAAGGGATGAGTAGTGCCCTTG
CTAAGTTCAACAGATGTGTAACAAATCTGTTGAGACCGGTGCGAGATTTCGCACCGAGTTACTTTGACGATGGGTTCGTCCATAGCCGGTCTATGGATGG
AAAGACGGACGTAGAGGCTCACAGAACACACGTTTGCCAGGTACTTACAGGTATGCGGACGCATAAGTTGTATGCTAACCTCAAGAAGTGGATATTCGCT
GCTAGCGAAATACCACTTCTTGGGTGCATCGTGGGTAAACACGGCGTACACCCTGATCCCGAAAGATCAAGGCGATCACCGACTGGCCCGTGCCAGTCGA
TGTCAAGGGACTACGGAAGTTCCTTGGGCTAGCGGCGTACTTGCACAAGTACTCACGCAATTACGCCGAAATGAATGTGCATCTTTCTTGTTTACTTAAG
CAAAATGTGAAGTGGTCATGGAGCGCTGACTGTCAGCGTCCCTTTGAGGGTTTCAAGCAGAGCTTGATGCAATTGTCCATTCTGGAGATTTCAGATCAGG
GCAGACCATTCCACGTGGTCTGTGACGCCAGAAATTTCGCGATCGGCTGTGCGTTGATGCAATTTAATACAGATGGCGCAGAGCGCGTCATCCGCTACCA
ATCGCGTCATCTGCAAGCAGCTGAGCGTAATTATCCAGTACATGACAAGGAACTCCTTGCCATGAAGTGTGCACTGGCGAAGTTTCGCGTCTTTCTCCTT
GGAGAGAGGCCGTTTGTAGTCTATACGAACCATGAGTCATTACGCAAGGCCGTAAATAGCCCACACCTCACGCAAAGGATGGCGAGGTGGCTGTTCTTCT
TTGCGGAGTACAACTTCTCCATGGAGTACAAACGCGGACGACTTAATGTCGTCACGGACGCGTTGTCACGCCGACCCGATTTCGAATCGGCTGCGCGGTC
CAACACTGGGGTTGATACCACTGTTGCAACACTAGTCACTAGTGGTACGTCGTCAACATTGCTTGATGACATAAACAAGTCCTACGCAGAAGATCAGGCT
CTTCTGCAACTAATGGATCATCTGGTGACTCCATTGTAAATCTCTCAAAGATTTACCGGCCTTGTATCGATCTTCCGCGGATCGATATACAACACGCAAC
GGGTTGCTGTATTATACAGTCGTTACCGGCTACACACCTCGTGTCGTCGTCCCACTAATGATATTTTGCGCTTACGCATCATGTATGAGTGCCACGATGC
ACCAACTAGTGGGCATAGTGGGCGTGAGAAGACTTATCTTACGGTAAGTCGCGACTTTTACTGGTCCCACCAGTATCATTTCGTGCGCAAGTACATTCGT
GCTTGTGAATTGTGCCAACGGGTAAATTCCATTCCTTAATCCCTTGCGCCACTACAGCCTCTACCAACTCCGGCAGAGTGCTGGCAGTCCGTTTCAATGG
ACTTCGTCTTCGGTTTCCCCGAAGACGCTCACAAGAATAGTAGTATCCTTGTGTTCGTAGACCGATTCGCCAAGATGGTACATCTTGCTGCAGTTAATGA
GTCAATCTCAGCACATGGTTGTGCTCGTGTCTTCATTGACACGGTATTCCCGACTCCACGGTCTACCCCGTGAACTAGTCTCTGATAGAGATCCTATGTT
TACGGCGGCATTTTGACATCCGTGTTCCGATCCCTCGAAACACGTGTGACTATGTTCTACTCTGACATCCTGAAGACTGATGTTCGGACGAACGCGTCAT
CGCGTCCT