Description :
From Genome Similarity Track
Location :
Scaffold_30:30996- 52132
Transcript NameFunction/comments
Physo_134100hypothetical protein
Physo_156832hypothetical protein
Physo_134101hypothetical protein
Physo_134102hypothetical protein
Physo_108750amidophosphoribosyltransferase

Sequence
21136 bases(100 bases per row)
GAGCAGAGTGACGCAGCAGTTGGAGCTGGCGGTGGAGTTCCCAGAACCAAGGAGTTGCCACTCAGAACAATTCACGCGCTTGCTGCTGGGCCATGTAAAC
ACCTCCGTCACGCTGCTACTTGCCGACAAAAAATCCGAGGTGCGAATGCTGAGTTTCATGCTTTCAGCGTAACATATGAGTCTAACGTCGTTATTGCTAC
CACCCTTTTAGGCCATCTTACAAGTTGCGGATAACACTTTATCTCGCTGGATCGATCATCTGCGAAGACTACCTGGCCAAAACCCAAAGCTGGCGTCGTC
TTTCAGTGACCGAACGTTTCGGATATTGTGGAAATGTGCAGCTGCCGCGGACGGCGTCAAACAAAAGTCGGCCGAAACAGCCAGTGCAGCCCTCCGCTTC
CGTTCAACAGCATTGCTATTCCTGCTGAAATGCTCCAATTACACTGCTTCGTACTTCATCCAACAGGTAATAGGTGGCACGCTTGCAAGACAATAGTGAG
CGAGGCGACCAGTTTCTTACTTCTTGATGAATCCCATACTTAGGTACATCGCGTTGGGGTTCAACACGAACGCGCTACCAAAAGATCTCAACTGGGGCTT
CAAGAAGTGTACGCGTTTTATGCTCGAGAAGCGACCGCATTGTTTCAAACCGTTCCTGATGCGCCACACATGTACACTGTGCGTGTAGTGATTGTTAATG
TGGATATATGCGCTGGTTTACTAATTGTGTTATCGTTTAACCCTACGATTTTGTGATGCGGCAGTCAGAATCGCTCCAGTGGGAGTACGTGAACTGGTTC
GAGCACTTCGCTACGGTTTGTGACTTGTCCGGAATGCACTTGAAGAGCGCGATGATTCTGAAAAGTGTGGTCCATTATGTTAAGCAATTTGGAAGCAAGG
GGGCCTCCATTCAAGCGTGCCTCCTTTATTCGATTGCGGGTGCGCTTTTTAGTGCAGCCGATTCTTCAAAAGAAGGAGTATGCCATTCATCAGAAAGTGG
GCGTGTTAGCGCTGCCTTTGATGAAAGGTTAATGTCTTGCACCGGAAAACGTTTTCAGGATCTCTTCGACAACACCAAGCCCAGCGAGTGGCTTGATCAT
TGTGAAAAGGCAGCGCGGGTGTATTTGAAAAAACTCGAGTCGTTGGCGCCTTACAGTTTTGTTGGCTTGGGCTCGCAAGATCACGGCTTGTTTCTGGCGC
GTTGTATTAAAAGAAGCTCGACTAAGGTATTTAACTATGCTATCAGTGTTCGACATTCTCAGAAAACCCAGTTATACAGACAAGACATCATGTGGTAAGT
GCCTTGCACATTCTTCGTCGGCGTAATTCATATCGTCGGTCTAACCTGATGTTGCAGCTTTGGGAACATGTGCAAGGCGTTGACAGGGCTTCGCTCCTCT
CCGACCCTTACAGATATCAAGACCATTGAAACTTTGATCCTAGATGAATCAAGGCTTCACCGAATGGCTGTGATGCTCTCGGTGCGATGTTGCAGGACGA
TGAGCTTTGACGCAGCCAAACCCGTACTGCACACGATGTCACAGCATGTGAAATTAGTCCGTGAACTACTGGATTACACAATGATGGATGGGAAGCCGAG
CGAATCAATTCTCCAAGGAATCCTTGGTGATCTGAACTCAATTGCCCGAGAATGCTATGCCTGTGCTTCAAGCTGCTATAAGGCAGGGATGTACCACGAT
ACGATTTCAGCTCTGGTCGGCGCATTCGAGCTCGCCGAAAGCTACTTGGAGTACGTTATGTGCAGCAAGCTCAGCATTGAAGACATCCACAAGGCGCACG
TGCATCTCAAAGTTGATGCAATTGCCTCTTTGCTGGCCCACTGCTTCCGCGAAGTGGGTGATGTTACGAAATCGCGGGAATTCAATGGGTTCTCACTATT
GTATTGTGGAGATATTTCCGAGAAGATCCCGCAAGCAAGTGTTGACAAGTACGTGTCCTGCATCCTAGAAGAACCAACATCTTCGGACGTTGATATGAAA
TTCTGTATGGCTGATGTGTTCAAAGCGTTTGTCGATAACGCAACTCATGTGTATAAATCTCGCCACATCCCGGAGGACCAGATTTTACGACTTTGGCGTT
CATTTCGATCCGCCTTCGAGCGAATGTCTGCCAAGATTGTGATGAATTTGCGAGCAAGTGCAAGCGATGTACCTGATCTTCCATCCTACGATACTGTGGA
ATTATGTTGTACGATTGAGAGCCATTTAGATGGTGTTTTGATGGGACGTGCGAAGAATTCCAACGAGTGCTGTGATATTCTCCTTGAAATCGCACATACT
TTGGCAAATCGCAAGCTGCTTTTCTGTGCCTACTACACGAAACACGACTTCAACAGTTTAATCGAGGGGCTTCTACACACGCATCGTTCTTTGGGTGCTG
CTGCTGAAAAACTCGAAGGTTTTACCAGTAGAGCAGACTTTGATATCGGAGGTGTTTACGGATGGCGTGGCGTGATCACCCTGGAGATGGCTCTCATTTA
TAGCTACGCTGGTACTTCTCATTGTTGTGACGCCGTTGGGGATATTGAAATCAGCGAAAGGAGTGCAATTATGGATATTGAGAAGTGCCTGCACTACTGG
CGGGTTGGCGAAAACGCATTCGGTTGCCTGTTTGACGAACCCCACGTGATTACTTGCTTGGAATCCGTCTGCAATACGCTGTCGTTGGCGTCGTGCTCTG
CAACAGAGAATGCGGCTAGACACTTGCTGAAGACGTTTGAGGTGTCCGAGATGAAAGGTACTACATTAGGATGTATCCCGTCCCCCTTGTTACGTGTGTT
TGGAACTGTAGCCAGCAAAAACGCATTGGTAGAAGAACCGCAAGTGATCGGTATGCAAGGGGCTAACAACAACGAAGAAGTACAGGGGTTCGAGCAAGTC
GACCTAGCGATCTCTGCTGCAAGGAGATCTCACTGTGATGAAAACACAGTCCAAGCTTGCCGACAGTTGCGAGATGCAGTTGCTATGCTGGGTGCGCTAA
AAGCAACTACAAAGCAACGCTCGACAGCGACGGTGGTAAAGGCGCTTGGACTGAGGGAGATGCTAGTTCACACGATTCTATCGGATATCCATTTTCGTGA
GGGGCGAAGTACTGGCGCTATCATTGAAGCTAAGTCAGCGCTCCGGATTTGCTGGAAAATGGCGAAAAGGTTCACTGCTGCATCGTCGACTGTTGAAGCT
GCGTACTTTGACCTGCCTTCTGAGTTATCAGCAACCGACTGGCAACACCGAAAATCGGCGCATCTTTATTTTATGGCCCTAGAAAGCTCGTCATGGGATG
TGTTGTATGCTGCGAAGGTGTCGTTGTGTCGAATAGCATCCCTCTACTGCTATTCAGACCAGCCTCACAGAGCTGCATCGTATTTGACTGAGGCGATGCG
GCTTGTGGGTGGATTGAATCTGCATTTGTTTCGTCGAACCCCATTTTACGAATTCGCAGAATTGGAGCTAAATGCGAGTCACTTGGAAAAGGCAAAAACA
GCAATATCGATGTTGTCGTCGAATTCGAGGATGGAACCGGTAATTCAAGATCTTGATATCAGTGGTTTAAGACCGAAGCATCATCCCTGTGCTCACACCG
ACTGGGCGTTCACAGAGCAAATGTGCAACGAAATGGTACAGCGAGGAGACGTGCACGTCATTGAAGGGGATAGACAGAAAGCACTGCGCTGTTACTTGGA
AGCGATCGAGACATTGTCCGCGGTTGAAAATGGAGAAGTATCTGAGTCCAGCGCGTTGGCAATGGTCAATGCTCGTTGTTGGCGGAAGTATACACGCCAT
CACAGCGAGATCATCGATTTATCTGACACAAGTGCAGTGGAAACACTGCTAAACTCGATGAAAACACTTAAACGAACGTTGAAGCGCTGTGGTGCACGAT
TGGAACGGGTTAAGTGCATGCTGGAATTAGGGCGCATAAACATCAAGCTGCTACGCTCGTCCTCATGTCGGGCGTTTGCAAGTCTGGAGCGGACGATCTC
TTTACTAGAAGAAGCCTACTCGCTTGGCGACTGTCTTGGCATTGCTCACTTAAGTCAAGAACTGCGGGCAACTTTGGGAATGGCGTATTTTGCTGAAATC
GAGGAAAGTGCCCACGGCGATGCAGATCGAATGGACGGTGACAGAGCGCGGTTTCTTTCATGGTCTAGCAGTGCACTGTTAGCGAATAGTTGCAGCAGTA
CCGAATGCGAAATGGTGTCAGCAGAACCTACCGATTCGGATGCAGAATTATCATCGAAGGAGGCTCTGATGAATCAGCTTGAGCAATTGTCAGCTCGTCC
AGGCGCAGATCAAACTTATTCAATTCGCAAACAGGTTGAGGACATGACCCAGAGCCTTTCTGAGAAGGTCCACGAGCTACCCAGCTCCTGGGTCATCGTG
TCCTTGATGATGGGTCTGTCGTCTGAACTTGTGGTTACTCGTTTTACGGTACGTATTCCTCGTTCTATTGGTAGATTGACAGTATGCTAACATCGTGATA
TGCGCAGACAAATGGCACTGCCCCGATCTCGTTTTGTCTGCCCAACGTTTCTTGGAAATCGTGTATAGACAAGATGGATGCCATCGTCGAGAAGTCAAGG
TGCGCTACTGTTGGTGTGACTGATCTCTCGCGAGGATCTGACGTTGTGTGTATGGCGGACAGGGAAATCCTGTCGGGCCACACGGCCGAAGAGGCAGGCT
CTTGGAGCACAAAGCAAAAAAAGGAGTGGTGGGATACCCGTAAGCAACTTGACGAGCGCATTCAGAAATCAGTCCGTTCAATGGAGGTGCGGAGAAAACG
AATGTGTGCTGACAAGATAGTAGTGCAAGTACTTACAAAAATCATGCTGTGCTGTGTAGATGACGCTTGGATTTTGGCGATGCTTGCTCGTAAAAGGAAC
AAGCACACTTGAAACGCAGTGCGTTCAGCAGTGTTGGAGTTTGCTTACCTCGAGGAAAGTATGCCCCGTCCTGCTGGCTGAGAGGAATCAAAGCTTGCTA
TGTGCAATCGCTGATGCGCAACAATGGTTGTCGGACGGTGAAGTGGTGAACGGATTAAAGCACATTGCTGCAGAAATTGATGTGCCCCTATCCGATTCTG
GGTTACAGGAAGCCCTTCAGTTATTGCGGAAGCTGGGGCAACAATCTGGGTTAAGCCCGTCACGAGCGACTCACTCAAGCTACCTACCAAAGCTAAGGAC
GGATAAAATCCAGAAGATGAAAGTGAGCGAGCTGAAACAACTTCTCGCTGCTGAAGGACTTAGCACTGACGGTCTGAAAAAGGTGCTGGTTGAGCGGCTC
ATAGCTGCGCGCGATGCAGCACTTTTGGAGCCTTTGACCGATCAAGCTGCGCGCGATCAAGGCTTTTCGACTATCTTGATATTGAATCACCAGCTGCAGC
AATTTCCGTGGGAAGGAATGGACATCATGGGAAGGAGCAGTGGCGTAACCCGAATGCCTTCTCTCGATCTGACCATGCAGAACGCAAGATACGTAATGCA
GTCACGAACGTCTAGCTACTCCTCGATTCGACGGGATCGCGTGCGCTTTCTTCTGAATCCTGCTGGAGACCTCAAAGCGACACAAAATCAGCTGGGGCCT
GTTTTAGAAGGCGGAGTGACGACCTACGGATGGGAAGGTATTGTTGGGGAAGCTCCAGATCCTGACAAACTGAGGTAAGCGTCTCAAAAATGGCGGTGCG
CATGGAGATGACTTTTCTAACTTCTTTTACGTTGCTGCGTATGCAATGTTGCCAACCGCAGAAACTATTTATTGGCCGCCGATCTGTATATTTATTGTGG
CCACGGCTCGGGCGAGGCGTACTTGCATCGCGACCAAGTGCTCAGTCTGAAGTCCGGTTGCAGCGCCGCCCTGTTGTTTGGCTGCAGCAGCGGGCGACTC
AAGCGAGAGGGTATCTTCGGCCCGAGTGGCGCTGTGCTGGCTTACTTGCGAGCTGGCAGCCCGGCGGTGCTGGCGATGCTCTGGGACGTCACGGACCGGG
ACATCGACCAACTGAGCGTCAAGATTCTGCGGGAGTGGCTTCTGAGCGAGGACGGCGACTCGAGCCCATCGCTCGCACGAGTGCTGCAGGACTCGCGAAG
CGTGTGCAAGCTCAAGTATCTGAACGGCCACGCTGCCGTGTGCTATGGCCTCCCACTGCACGTGGCAAAGAGCTGAGCAGCGTCCGTCGACCACTTCAAC
GTGAGCCGTCTCACTGGTGTACGCCACACATCCTGCAGTTTCTACGCAACGCGCGACATGTTTAACGTGTGAGTAATGCGGAGCGGACCAATCGGGTGCG
GCCACTGACGTAGCCCGTAACGGCCACTCAGCTGCCGAGGCTTCGGCCAAGCGAGCGCCGTCTCCGTCACCTCCATCCATCTGGCAAGTTCTCCCGGAGA
GTGCAAGTGAGAGATGGTGCTGCTGTGCTCGACGCCGCCGGCCCCACTGCCCGTGGACGTGGCTGCGACCCGCCCGTTGGTGCAGGAGCTGGCGACCTCT
GCCGCCGCGCGAGAGCATGTCCGAGCGTTGGCCGGCACGACGTACGGTCGCTGCGTGCTCGGACTAGGTAAGACTAAGAAGGGCTGGCTGGATTAGATTC
ACGGCTATTGAAGCACTATGGGCGTGCTTGTGTTTTGACGCTGCTTCTGTGTTGTAATTCCTGGCAGCGGGCTTCCTGACGTACGCGACCGAGCACATGG
CTGCATTTGTCAAGCGCATGCACGGTGATGTGAGCTCGGAAGATCTGGCAATCACGCATGAGGTACGACTGAAGCTGGTTGTTGCATTATTCAGCAGGTC
TCTCGAAGCTGATACCATACTGTTGCTTGCAGATGCTTCTGCTACTTGCTGAGACGGTGGTTGACGAGGACAATGCTACATTTATTGGTAAGATCTCTGA
TGCAATGACACTATGCTAGTTACTTTGTTCCCTGTTCGTGGTACTGATTTGTCCGTAAATTTACAGCGCGTATTGGAGCACACCCTCTCTTGATGCGTCT
TATGGAGAACGAGAACGAGGATATTCAAGAGGTCAGCATTTCTTGCGTTGGATTGCGATGTTTGGAGTTGCGAGACACCTCACTAATGTCGATGCGCGGA
TGAAAAACGCAACAGGCGGCTGCCGAGGTTGTCACGAGTTGCACAAGTAGTCCGTCGGCCATCACATTCCCGCACCGCGTGCGACAAGTGGGTGAAGTGG
AGCGCTTGTGGCCGCGTGCGGTGCCGCTCCCTTTTGATCCCCGAGATAACGCTCCGAAGAATGAAGACGGCTCTCAAGGCACACTGGAGGTGCTTATTCG
TCAGGTGCCTACGCGTATGACAGGACAGAGGAAGACTGGATACCTCCTATGGGGAGCAGCTTTTGTCCTCGCGCGTTGGATTCACAAGCACCGTGAGCTG
TTTGAAGACAAGAGCGTGATTGAGGTCGGCAGCGGTCTCGGACTCGGAGGTATTGTTGCTGCCCGCTATGCAAGGCAGACGACGCTGACGGACTACCAGA
GCGATACGTGTACTGCTCTCGAGTACAATGTCCAGCTGAACAAACCGTTTACGCACGAATTTGACCCGACCAAGCCGGAAGTGAAGGTAAGCCTCTTGGA
TTGGGACACCTCTGAAAGCATCGAAGCGGTTCCCAAGGCAGAAGTCGTGATCGCCAGCGACATCATCTGTGAGCCGAGTACGGCTGAAGGTTTCTTGCGT
GTGGTTCGACACCACGTGCTTGGTAACCCCAACGGCGTTGCCTACCTCATGAACGCTAACAGCCACAGCCGCTTCGGTGTCATCCACCTCCACGCTCTTC
TAGCCGCCAGTACTGATCTTTCCTACAGCATCACGCCTGTGGGTGAGCTGCCTGATGGCGCAGAGCTTCTTGAGACGGTCAGCGACGCACAGGAGCTCTC
TTACGAGTTCTACGAAATCCGTGCGGCATCTCAGTAAACCGAGTACTAGTAGTAGAGATCACAGGATACAAAGCCAAAGCGTATCCCGATAGGATTTCAA
TAGAGTGTTTAGAGAAGTCCTATTGATCTTTCGGTCGCATTGCGTTAGTGCTCCCAGCACTTCGGCGGAGAGGCTATCTAAACGAGGATATTGTACGCCA
CAGGTCCAGTGCATCGCGGATCGTCTGGAAACCCGTCCCCGTTCGGATTCGAATTGCCAGGAATGCCAGTGGCAACACAGGAGCAGCGTCCTGATCCACA
ACGGTTTGACTTCGCGCGTTGAAGCATTTCCTCCCGCGTCTTGAATTGTTGGCCAGGTTGGGGGCAGCTATAGGGCATCCTCATCTGCAGTCGCTTCCAC
ATGGGGCTGTCTTGGCACATGAGCTGCTGTGCTGAAGTTAGAGTGCAGGAATTGCAAGTCCGACAAATACGATCTACCCCTGCTGCACAAGGCGAGACTT
CGTACTCGTCCAACGTGCATTGAGTACACGGTGAGCATACTCGATCCGTTGTTGGGGAGCAGGCAACGGAAACGAATTGGCCCGCTCGACACTCCGTACA
CGCTGGTGTTTGCATACACAGAGGCACACGATTAGCCTGTGCATAGGAGTTTTGCGTGTCTAGCAGTACACTTACGGTAACAAAGCGTATCTTGCGTAGC
TCTGCAAGCTTCAAGTGCAAACGAATTTCCAGGACAAACGCTGCAGGTTGCACAGACTCGGTTTTTAAGATCTGAGCACGAACTGACGAGATAGGATCCG
GTTGGACACGCTGAGCAGTCTGCGGGTGAAACTTGAAGCAGTTTTCCGGGGCCAACGATCGTCACAGCGTTACCGGCAAAGTCTGCGACGAAGGTGTTGT
CAATTCCCAGAAATGTGTTTGCCTTTGTGATACCGACCTGGCCAGTACCAAACGCGTTTAGAGCGGTGACATCGGTACGGCCCAGTTGTAGAGTAAGAAA
CGTGTAGTCTGCCGGCAGGCGATTTGAATCTCGTAGCGTGGCGCCACTCAATGGATCTGGCTGAGGCGAAAACAGACGCGTAGTCGCAGATGAAAGTGGG
TAGACATCGATACCCGCCGCGGTCTCCGAGAATGTAAGACCCTCGATTTTAAGGGTGGCAAAGTCTACGGCTTCTGAAAAGTGCAGCTTCAGCAGGCGGC
GTGGCAAATCCAGACTATAACTCAATAGTTTGGGTGGAACAGTATCTGCCTTGAACTTGGTGACACTGATGGCTGCGCTTGAAGGTGTGGCTACCGTCAT
CATCGGAGAGCAAGCAAGGATCCCGCTGCTTTGGCAGTTGTTAAGCACGTACTGGAAAAGACCAGCATCGACGCTTAAGAACGCGGTATTTGCGCTCTGC
GCCAGACCGACTACACGTTTGAGCGAATTGAGATCCCCCACACCAATGTTAACCACAATTGTTGTTCCGTCCAAGCTGCTCGTGCTCGTCTGCTGCGGAG
AAAACCGAAAGGTAGCGCCATACTTCAGCTCACGCTCGGACTGCAGTAGCAGTTTGCTCACATCCAGCGTTGATGCTTGGACTGGAACGTTCATCCGGAG
AGTAAGCGCACCCAATGCCATATCGAGATCAAATGATTCAATATGCGGACCTTGGGCAATTCCTACCAGCACCACTTCGAGAACGTTACAATCTCCGACT
GTTGTTCCAGTCACGTCGGAAAGTTGCAGCCAGAAAGAGCGCGGTCGAGGGTCATAGCTAGTGGGCGTTAAGATTTGCAGAACAACGTACTTTACCTCAG
AGTCGCCATTTGCCCAAGTGACAGCAGTGTTTATGAGTGGCTCGAAATCCACTCCAGGCGTTGCTGTCCCCGCTACAGTATTCACGGTGACGCGTACCGG
GACGGGAAAAGCTGCAAAGTTGCGTTGAATGGCGACCGACAGCACCCCTTGCTCGGTCATCATTACACTAGGACACAATTGGAGCCGCGAGCTTGTGTTG
CGCGAGGCCAGCTCGATGAAGCTTAGATCTGGAACTTTCAACACAGACTCCAGGGGCTCGCGAGCAGCGAAGTTGATGTCACCGAGGAACACATTGGTCA
CACTGGCAATATCCACGTACGTAGTACTCGCATGAACGCCGTTAATTGGGGCCCCTACGCTATTTCGTAGCACAATCGCGACACGTCGAACTGGTAGCCT
TGGATCTGGTCGAGACAAGGCTTTCACGATAATTTGTCGGTCGCTGACGTCACCTTCTTTCCATGACAGCGTTTGCTCTAGTGGTTCGTAGTCCAACCCT
GCTAAGGCCGTACCATCTTGAGTAGCAACTGTAACGGAGCAATCTCCGTCACTCCCATTTCGTCGCTGGACCGTCAGGCGGGCGGTGCCTCCTGCGAACA
TTGAGTACTTGGTACTCGCGCAGTCTGGAAAACAGTCAGCATCGAACTGTAGAGTGCCCGACTTTGCATCGTTCGGACCAGCGATGGTCACGACCATTTC
TCCAATGTCTCCTATTGCCCCTGTGCCGATCGTGTCACCGTCCGTGGCCGCCACTTTTACTAAGCGTAAAAGGAAGTTCTCCGATAATTCGTACAACCCA
TCGTCTGGAACTTGCAACACGATATTCTGTGTTCGATTGGTAACACTGGCTGGGTAATTGTCACGCTTCCACTGCAAAAGCTGCGTCAGTGGAGATACCA
ATTCAAAGTCTCCTGGCGAGCACGCACTCTTGCACACAATCTGAAATTTGACACTAGCAGTCGACGTCGTGCCAGCGACCCAGAGAACAGGAATGGTTAA
TGTGTTGCCTTCTGATATAGTCACTGCGGCGTCCTTAAAACTAAAGCTACCGGGTACGACTGGAAAATGCAGTGATAGTCAGTTGTTTGCAGCGTACCAG
CATCGCAAGAGATTCATACAACTCACGGTTGGAAGGAGGTACCAGCACCACTTGTGTTCGGTTGCGATCTGGGTTGATGTCCGCTCCAATCGAGTCATGC
AGCTTCAACATGAAGATTTTTGGGCTCTCTTGAGGTTTGCCGTCGTTGTAGATAGGTAAGTAGATCGCCTTCTCAAAGTCTTCGCCATCCTGCCACACGA
GACTGACGTTGAACAACGGTTTGTAGTCTCGCCCAGCAACAGCGGTCCCCACACCGGGAATGGTTGATACATATACTGCAGCACGACCGTCGGATCCAAG
ACTGCGCTGCACCGTAATGTAGGCGACTCCAAAATCTTCCGTAGTAGAGTAGACGGCTTGGGTGAACTGGAACCTTCCATTGGCAGCGGCATCAGCACCT
CGTAAGGCTTCAAACAGGACAAGAAATCCCACAAGTAGCAGTAACCAGTGGTGCTGGCATTGCCTAAAGATCGCCATGATCGACAGCCGACGCTTTGAAA
TAGCTGTTTGGTTTAGCTGAACGAAACCACACCGACGCTTCATCGGTCATATCGAAAACGTAGACTTCTGAGAGCATGGCTGAAGTAGCCCGCGGCTTCT
CTTAGTGTTTTTGATCCGGATACTGCAAAATGGGCAAGGTGTCGGTAGCTCAAGTGCCACAGGATGTCCCTGGGAGTGCCTCTCGCGAGATATTCCAGGG
GCTCTTCAAGGACTTGGGGAAGCAAGCGATGGCGATGGAAGCTATACTTCGAGCGGTTTGTGGTCGTGTGGACAAAATGGAGAACTGGCTGACAGAAGTG
AGCTTCGGCATGACGGAGCTGGATCTGAAGTTGAGAAATATCGCGCACAATATCGACGGAACGGCAGCGGTGGATGACGAAGCTCAAGGACCACATCGGT
GGGCCATTCCTCCCCCTGACGACGCGAAGCCCTTGGCGCCAACAGTAAGCAAGAAGCTTGGAGCCGACAAGAAAGCGGTCCGTGTGACGGGAATGGCCGC
TGCTATCTTGGACCGACTCGCTGCACCTTCGACAAGCACTCCTACTGCGGTTGAAGCAGAGAAAGTGGAGAAATCTGGAGCGAAGAAGAAGAACAAGGAG
AAGAAGCATGGTGCTAAAAAGGCGAAGATGAGTTGCCTTCCAGAAGTCCCAGTAACTTCGTCGCTTGCTGCAGTTGAGGTTGCTCCTCCTCCCGCCATCC
AGCTGCCTACTCCTATGACGTCTGCTGAAGCTCTACATATTCCAGCACCCGAAGACCATCCAGTGATAGAATCGATGCCGGTTCCTGAGATTCACGAGGA
AACACCCGGTGCATCGACACTATCTCAACAAGCACCAGCGCTCCAGCCTCCGGAAAGGGAGGTTGCGGTGGAGGATGTAGTTGTTTCTACTGCGCCGCCG
AATGTTGATAACATACCACCAGCAACGCAGCAAGAAAACCCCTTCACAGTCGAAGTTCCTGTTGAGCATGGCGTCACTCCAGCCGAATCGTTAGCGGAGC
CACAACCTGTGGAGGAGCACACTGTACCAGTTCCGAATCCGGCAGTCCCTCAATCTGAAGAATCCTCAAGTGAAAGCAGTCCAGCGATGTCACCAAGGGA
AACAAAAACGATTGAGGCATCGGAACAAAGCCCAGCAGCACCGATAGATCATGTCCAATTTCAAGAAACTGAAACACCCCCGACAACCAGTGAGCAAGAT
TGTGGTAACTCCACGCCAAGTACTACTACTTTGGAGCAACATGAGACCGTTGTTCCCGCCCCCGAGCCATCGCCACCGGTACCAGCAACATCTCCGCAAG
ATACTGTCACCGATATCGCATCGGTGACTTCGGCACCGAAGGTAGCAGCCCCAGTAGTGAAGCCGGTTGCCAAAACTCCAGAGCCAACCTCATCAGTCTC
AAGTATTCTTCCTACTGTTCAAGTTGAACGAGCTACTGAGCCGTTCGTATTGAAGGGATCGGCGCATACAACCACGGCCCCTGTTACTCCTCCTCCTAGC
AATACCCCTGAACCAGTCACCACCGTTTCGGAGCCTCAAGCAGCTACTATTGCGGATAATGTGGTCGTGATGAAGGTGGACGTGGAATCCAACACAGCTT
TAACAACACATCATTCGGCGAATAGTGACAAGCGGCCAACATTGCCAGAATCTGTTGCGGTAGCAACAAAAGCAGTTAAGCTTAAGGCCACCGGAATCCC
GACGTCGCCACCATTATCCCCCCACGCTTCAGAAACAACGGGGCCAGCAGTTGATCCACTTTTACCGCACAGAACTGCGGCACATCGACGATCTTCAAAA
ATGGCGGCAAGACCAAGTCTTACAAAGAAGCTTGAGCACGGCGCTGATAGTGATCCGTCACGGCGATTATCAGGAAATAAGCGTGGATCGGACTTGACAC
GAAACTCAATTGCTCCGCCAGCTCAAGAGCACCCCTCTCATCATCCAGTACACCAACCTTCACAGGTCAATGCACAACCATCGCCGAGCTCGCAGTCAAT
ATCTCAGGGTCCAGTCACGCCCACGATTTCCACGGCGGCAATGTCTGAAGAAATTCACGAAGAAAGTGGTGAAAGCGGCAGCGATTCCTCATCAGACGGA
TCTGGATCGTCTAGTGAAGATGAAGATGCTGAAGCGGGAGCTGCCGTCGAGGAGATTTCCAACACTATGACCGCTCTAAAGAAGCTGAAGCGAGCTCAGA
TGCTGTCACCTGAAGAAGAAAAGGAGCTGAAAGAGCGAGCCCACAAGAAATGGTTCCAGCTCAAGGGTCATATCAAGGAAAAACAAAAGAAAGATGTGAC
GAACATCCTACTTAAGCGCAAGAAGAACGTATTCACAGTATCATCGAGGATTGAGCTGCTGGAAGAGAAATCGCGTGAGATTTTCGCTGCACTCAAGCAG
ATTACGAACGAAATGCGCGACAAGAGCGACCGTGCTACGCATGAAACGTTGCGTCGCCGCGTTGCTGATATTGAGCACAGTCTGCAGAGTATCGATTCCA
GAATTGCGTCTTTGTCAGCGCCCGCATTTGAGAAAGTTGGTGACCTAGAAGATGAGGTGAACTCGTTACGCAGTACCGTGGAGCTTCAGCTTACGACCGC
CCAGGCTGAAGCTACAGCCAGGCATTCGCTGCTTGAGGAGGCTCTAGCTACTCAACGAACACTGGTTGAATCGTTGACCCAAGATTTCCCGGCCCAACTG
GCAACCCAAGCTGAGCTCTTCAACGAAAAGCTCAAGCAGCTACCCGACTACACTGCAGCGATAGAGAACCTCCGACGGGGTCTAAAGCGCAAAGCGGATT
TGAAGCTCCTGAAAGAGTACGATACGCGCAAGCTTTTCGCTATTCACCCGACAGATTTTGATAAACTGACGTTTGGATTTGCTCTGATATGAACAGGTTA
GAAGCTCGGTTGCTCGGTCTGGATGCGGAGAATGAGGACTGTCTGGTGCGCTGCTTATCCTGCCGCAAAGAGGTCACTAACCCGTACAACGACAAAGATA
CTGAAGGCGATGATCAGGATATTGTGAGCTCTGGAGGTGGCGTCTCACAGCTGCGGAAGATTAACACTGGCCCAACTTCGTCTCGGATCTACCGCTCAAA
CATACCATTCAGTGCCCAGCCGATGGTCCAGGAGGCCATTCTAGAGGAATCCCCTGATGAAACCTTTTTGCCACCTCAAGCGTTGTTGCAGCCACTGCCA
CAGTCGATAGCGATGCAAGAGCCTCAACTTCGTCAACAGCTCCAGTCAGCGGGGGATTCTCATGCAAGTGAGAAACCTCCAGTTGTTCGTGTCCCTAGCG
TGAGGTGGTCGACCCCACCAGAATCTTTGAAACGAGAGGCCAAAACCCCACAACCTTCACCTCTCAGGTAAGTTTTGGGCCCATTCTTCTCCTATCGTGG
TGGGCTTCAATTGACGTTTTTACGCAATGACTGTTCCCTGTAGTTTGATGAACATTACCGCGACGCGTGCCATTCTATCACCCGATCGGCCGATCAGCGC
CCCCGTGATCCCAATTAAAAAGAAGGCAAGTACCGCAGTCAGGTCGAAGTCGGTATTAAAGTCACTATCCTCTTCTTTAGATCCACCTCAGAAGGACTAG
TGGTAAACCCAGCGCTGTCCAGATACACCACAATATATAGCTTTTCACTTACTTCCAGGGTTGCCTTTAATATGAAGTAATCGCCGACACAGTCCAGACC
TCTTCCTGTCATTCTCCATATTCGTATCGGGAGTGATAACGTCGACCAACCGTCCTCGACTTGCGAGTTGCCGCGATGGTGGACGCCCATGACGTTGGCG
TTTCTCAGCTGCAACATCGAGTTTTGGCCCAAGCTTTGGCTGGAGTTGCTGATTTGATAGCTCCGCAATAACACGAGTCTCTTTGATCAACTGAGCACTC
CTCATCGAAGCAGCAACCACAGCAGGATCAACGCACAGTTGGAGATCGTGGTGCCCAGTATCTTGACTGCAGTCGTATTGTCCGGCGCGGCGTAGCGAGG
GAAACAAACCTTCTGCATTTTGTAAAGGTGTCGTGAATGATCCAAGAGCTTTTATGGGCGACTTTGTTGGCGACGTGGGCGCCGACTCTCTTGGAATGGC
TGTAGATCCTGAAAGTGGGGAATATCTTCTGTCGTTGTTTGGCCTTGTCGGTAGTTGACGATCTCGTAAATAGTGAAGCAGGTCCATCTGCATTGGTGGC
CCAGGCAACTTTGTAGATGGGGAGTTGTTGGCTGTTTGCATGGTTCTCTTCAACGAAGATAGGTGAGGCGAGAGAAGAGGAAAATCTTTCTCTTTTGGAG
TAGTTCTTTCTGCCAAGCGTATCGAATGCGTTGCACTTTCAGCCCTATGCTTCTGTTGAGCCGCAATTGCTGCTCGTACAGTTTGAAGCCCTCCACGTCC
GAGCAATGCCACAATGAACAATTCTTGGTTTCGCCGTGATAATGCCCCTGTCGCAAATGTTTCAGGATTGCATCGGTACAATTCAACGCCCAAAGCATTT
ACGATGGGGGAGTCTGCAACAGCGTACTCTGCGTCAGGTAACTCCGTCGAGGTATTACTGTTCGTCAACAACCCCCGGTTGGTAGCATCACCCTTTTCAT
CAGCATACAAAATCGTACATGGGCCCAAAGAGGCCACTGGAGTATCAATCGCCAGTTTCGGACTACCAGCAGTACTTTGTAGAGGGACACGTAGTGGGGG
TTTCCGCCGGGGCTTTCGCTGAAGTGCTACGTACTTGTGCATAATGCAAAGTCCGCTTTCAATCACGAGCAAAGTTTCCCGAGGAGTATAATTCCCAAAA
ACAACTACCAAATTCGAAAATAAAAGTGTTAGGAGTGTAGTATTCTACGATAAATAAACGATGGCGTCATTGAGCTTACCTTCGTTGCGCTTGAAACTGA
GCTCTTTCACGGAATAGTACATCGAGCATAGTTGTTCTGGTTCGAGAGGAGATGCAGCATCAAATGCTCGCTTAAGCGTCGCGAATTTGGATTTGAGACG
CTCTCTCTGAGGCCACAAACTAAGGAATACCGCTTTGGGGACCCGAAGAAGTTTAGTGGCCGTACTTGACACAACCGCTTCAATCAGACGTCTATTAGAG
TCAAGCATGAGCTCAACCTCTCCAAACGTATCTCCTGGCTTCAGCACTCGTATTGATACTTTGGTTCCCCGAGCATCTGAGCTGGTCCCCGCTGCTAAAG
ACCCAGAAGCCGGTAGCGGTGAGTCTAGCACTTGTTGTATGGTGACGGAGCCCTCGATAACCAGGAACATCTGATCAACCAACTCCTCGTCTCTCTCGAA
CACGACCGAATCGAGCGACGCAACTTCCACCATACAGTGCGTGCATATCTCCAGGTATTGTTGTTTTGGTATATCCTTAAATATTGACAAATGATGCACC
ATCGTATACGTCAGTCCTGCACGGTAATGAAACTCTTGCTCGAGTTGTGAGCTCCATCGAGGTCGCTTTTGCGTAATTCGAAATATAGCAGCTTTCCAAT
TGTTCGCCGTTGATCTTCGATAACGAGCAATATCATTTAGTTAGACAAATACATATCCAGCAACAGTTTGAGTCTAACTGGTATGGTTTACCGTTTATGC
AGTTGAGAATGATGCGTTGCTAGAGATAGGCGGTCTTGGTTGTGATCATGAGAAAAACATTTTGGAGATGATACCTCGATAAAACCATCACGCAAAAGAT
ACACCAACTTGACAGTTTTGTTGCCGTTGGCTCCTACAACAGCTACCGCTGTCGTCAAGCGTCGGCTATCGCCAATAAGGCATTCTTCCCCAAACGCGTC
ACCCTCGCACAAGTCAATAGACCAATAGTCATCTGCTGGTGATGTCGGGGGAGACCTGGTTGCTCCTGGGCTGCGCTCCCGCCCGTTGAATCTGCATAAG
CAAGGTGCGCACTACGCATCACTACCTGAACATCGATCCCAACTCGAGCGAAAAATGGGTGAAACTTACAGGCGCACTCGACCAGATAAAATGAAGTATG
CAGCAACCCCCTCTTCGCCACACCTGTACACTATAATTCGCAGAAAGACAGTTTTTTTTTCTCTGACGTATCCCTGCATTTTTCGTAATAAAACAATCTT
ACCTGTGTTTCCAGCGCTCATCTCAATATACTGCAGAGCATCAGCTACTTTATGGAGCTCATGCGTAGTTAACCGCTTCGCAAGACCCATTCTCTCGAGA
ATTTGGTAGCGAGCGTTTTTTAGTGAGGAATTTGTTTCATCTCCGCGTACTTCATGTTGGTCCGTATCCCGGCCTTCCACAGCAGCTAGTAAATCTTCTT
TAACTTCGGGGTCCAATGTGTACATATCGTCAAGGGTACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCAAGTC
AACGACATGTTTGTAATCACGAATATAAAAGTCATCATCCACTGGTTTGGTAAATGCAAAGATCCCTGGTTCTAGAGCCCTTGCAGAATCTTGAGAGGTG
ATAGTTTCGGTAGCTGGAAATTCTTTTACGCCACCTTTAGAGCGAGTAGATAATCTCTGGTCGCTTTTCATCTCCGCTACCGGGCCACGAAATATCCTAA
CATGACCTTCAAGGACAATGAAGACACATCCTTTCGTAACTTCTCCCGCTTCGAATATAAAATGGTTAGCTGGGACGTTGACTGTCTGCATTCGGCCAAT
CATGAATTTCAACTTGGTGCTCGGAAGTCCAGAAATCGCAGGACAATGATGTAAAAGTCGCTCGAACTCGCTCTTCGCGTAAACCTTCCGCGGTGCACTA
AGCTGCAAGCGTGAAGTGGTTCTCACGGCTCGAATAGTTTGCCGCAATGCACGCACAGGATGACAAACCAAATATTCGTCAATTCGAGCAAGGCAAATTC
TTGCCAGTTCGCCTGGAATACTAAGAATTTTGGCCGGGTTTCCAGGAGAATCCACGCCAGCGTATGCCACATATCCGAAAGGGCTTGTGGAACCGAGGAG
TACCGGCAATAAACCAAACGCACTGCCGCGACAAAGTACTCCAATGGGCTCCACAAACGCAGCACCTCCCTTTCCGAGACACGAAGGACTTTGGCTGGTC
GGTGCCATAGGAGCATCTTCTTGATTGATTGGCATGCAATCTCCTTCATCACTGCTGTATTGTGCATGTTCGTTTCTCGTTCGATCAGCTCGTGCATGAG
TTCTGAATACTCGAAGATATCCATCCAACAAAATTTTGAGACTCGTGCACTCTGCCCCTTGTTCTTGGACGCACGTGAGCTCTTTTCCAACCACGGAATG
TGTGTCCAGCGTAGCGCTCAAACAAAATTGCCGCACAACAGCCAGCGGGAGCTGATTGAAGAACGCCTTCGCTGATGAATATCTTGAGAAAAATATTTCT
AGATAGCCCAGCTGCTCGCAGGTGCGGTCGCGCGGAGGCCTTGATGTCAAAATGCTGTAAGCTGTTGAGACTGCAAAATCCGTGTCCAGATAACTCAATC
GTGAGGCGAAATAGTCATCAACGGCAACACTTATTGCGTAGGACGCGTCATCGCAGCCTTGCGGTACCGAAAGCAACACACCTTCGGCATCAGAACGGTT
GAAATTCAAGGAAGAGCTCAAAAGAAAGCTTTCCCCGTATGAATCTCCTTCAAATAGTTTGCCAATATGAATAGCCGGAATCGTTCCTGGTGCGTGCGTC
TCACAGCAGCAAACGGTGTCGGTGTCGTGATCTCTGAGCAGCTTAGCATTTGACTTTAGGTGGTTGAACGCCGCCACGTTGCGGCTTCGATCCGTCGCTA
AAGCATTCAATTGAATTTCTTCCGTGCTTTCCGGAACGTGAACACAGCACTCACCACTCAGCAAAAAGTATACTTTGGTTACGCCATCGTAAGCCGGGTG
CAACCTTTCACCAGGTTCGAACACGTGAAGTTGTAGCTTTTGAGCAAGTTGAAGTAGAATATCATGCGGCAGCTTTCGGAAGCATTCGTAGCGATGGAGA
AACCGCTTCACTACTCGCATGACATGTTGGTCAGCTAGCATCGCTGTATCCAATCGAAAGGGCGCTGTAGAATGCAAATCTGGCTTGTTGAAAAGGAGAT
GAACATCGCTCAGTATTCTTGCTTCCGCCTCCACGTTAAACCGTGCGATACGAAGATAATCCGCTTTCGTGACGAAGGCTATCACTGCGTACCAAAATCA
ACAAGTAAAAATAAGACCCCATATTTTGCAGCAGCCAAATGTACAGCGACCAAGATTCTTACACGAGGTGGTTTGCGCCAGCACTGTCGTCTTCCGAAGA
ACTGCACCAGTAGTAGCATCCTTTTTGAGTGTCGTGCCAAACCACAAATATGTTTTAGCAAAAAGGTAGGCAGTATCCCAATACCGTTCCCAGCGCAACT
ACCCACCTCGCCACAGTTCGATCCTTGGTTGCACGTGCCGATACACTTGCCCAACCTGTCGACACCTTCGCCACTCCTACTACCTTGAGGGTGATCTCCA
GCATCTTCCTGCTTGGAAAACACCAACAAAGACCCCAAAACGACAAGAAATCGTCCACTTGTATCGTCAATGGCATCTCCTTGTCGAAACACCGCCTCCC
CATCATGCACGACTCGGAAGTGCAAAACTCTGGCCAGTGCTGCATGCAAACACGGCATTTCCGGCCGTTAACACCTAAACCACCCATTCCACCGCAACAC
CACAAAGTGTCCCACCGTCAGTGGAAGCCGAGGACAAGCCGGCGTTAAACCTGCTCCGCCGAAGGAGCTCTGCCTGGTGTGCCACACAACGTCAGCCCAA
GCAATTCAGCCACCCAACCACCACTTGAAACTCTCCGCACCAATAGCTTGACGTCCACGTCTGAGCGGCAGTGGAACCTGTTGACAGCCATTTCCACTCA
GTAACTTTCCCTCTAAAATAATTATTACCTATTATTTATGCAACAAATTAGTAAAATAACCTACGGTTTAGATACGATCCTCCGCAGCAGAGCTCTCTTC
TTGTCCGCGCAACAGCCGTCGACTTCGTACGGGAACGCGTCGCGGAACGAGGTGCATGTGTGCGTGGGGGCGGCCGCCCGCCTCGAGCGCAGCAGCCGCA
GCACGAGCGCCGCCGCTCGCAGCGTGCGCCACCGCCGGCTCGGGCTCATAAGACGACTTCAACCTGGTTTTTGGGCCAATCGCCGCGCAGGATTTGCAGC
ACTCGTTTCGTTGGCTGAGCCGAACACGCAGAGCGGTTTCGCGGGGCATACAAAGCGCAAGGTATTTTCGTGGCAGCCACTCGCCCGGCCTCCGCACCCC
TTTGTCAGTTGTCAGTTCACTCCGTCCGAGCGTCAAGCAGCGCTCGCTTAGCTCCAGCCTCAGCCTCAGCCCCCCCCCTCCCTCTTCAACCATGTGCGGC
ATTATCGCGTTGATGCTGGCCAACAAGTACGAGCACTGCAACCAGGGGCTCTACGATGGACTCACGGTGCTGCAGCACCGCGGACAAGGTAACTAACTAG
GCCACGTCAGGGGGGTTACTGCTGGGCTAACGGATACTTGCCGCTTGTTGCGAATTGCAGACGCTGCCGGCATCATGACCTGCGAGAAGAAGCGCCTGTT
CCTGCGCAAGGACAACGGCCTCGTGCGCGACGTGTTCAAGCAGAACCACATGCTCAACCTGCGCGGCAACATGGGCATCGGCCACTGCCGCTACCCGACG
GCGGGCTCGAGCTCGAGCTCGGAGGCGCAACCCTTCTACACCAACTCGCCCTACGGCGTGGCGCTCGCGCACAACGGCAACCTCACCAACTCGCACGAGC
TCGTGGACCAGCTGGCCAACACCAACTTCCGCCACG