Description :
From Genome Similarity Track
Location :
Scaffold_17:309927- 315242
Sequence
5315 bases(100 bases per row)
ACGCGTCCACACTCTTCACTCGTGTAATCCATATGATACGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCA
ATCGGTGCCAACCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCA
AAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGAAGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAA
CTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCTACAGCTGTCACGAGCACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACG
GTCGCCCAGACCTTAACTGAAGAGGAAGACGTCAGACACGCTTCCTGTTTGGGTAACATAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAG
ACGTCGGATACGCTTCTTGGGTGAGTAACGCTGTACCACACGAGGTCTCGGGCGCCTCGGATGTCGTAGCGCTGACATCCCTAGACATGGGCAGCAAAGC
TCCACATCATGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCACTTCAAGCGACTCGGAGGCCAGG
GCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGGTATCACATCTTCGATGGCGAGACCGCTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAGCCGG
TGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGCGATTGCTGAGATGGTGCTCATGAG
ACCTAAGACCACTCGGGAGGAGCTGAACACCTCCTCTGGCTTGGACAAGAACGTCCTGGAAGACCTAAACAATCAGCGTCAGATGCGCTTGGGTTCTGGG
ATCCTTAAGAACCCCAATGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCGCCGACCCAACTCCCACCGGATCGAGGCG
TACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTTCCGCGCGAGCAGTGCGAGGTCATTGATGCCTTCTTCGC
CGCCAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCAC
GCTTATAACAAGCTGAACAACGCAACGGTGTCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGTGCGTACTGTACAGTG
CTCTAGATTTGGTAAACGGATACTACCAGATCCTGATGCGCGAGTGCGACATTCCGCTCACCGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCT
TGTCATGCCGCAGGGCTTGTCTAACCCCCCGGCGACATTCAATCGCCTGGTGACGCAATGGTTTAGGCTACTGCGCGCCTTCGTACAGACGTTCATCGAC
GACACATTGGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGC
TCTCCGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGAGCTGACCCAGACAAGGT
CAAGGCCATAGCAGCATGGCCGACTCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCG
GGCTTCGCTAAGTCCTTGTCGGGTCTCCTTTACACGGATGTCGACGGACGCTGAGAGCAAGAGGGCCAGGATGCCTTTAAAAGTACCAAGGCCAGTCTAC
AAGAGGCCCTTGTCCTGGCCCTGCCGGATGAGACGAAGCCATTTAGCGTCGTCTGCATTACCTCCGACTACGCCATCGGGTGGGCACTGCTGCAGGCCGA
CACGGCTGGCCATGAACGAGTCATCTCGTTCCAGTCAAGGCAGCTCAAACCCGCCGAACGGAGCTACCCTGTCCACGGCAAGAAGCTCCTGGCAATGAAA
TATGCCCTTGTGAAGTTTTGTGTTCACCTTCTGGGCTCGAGGCCCTTCGTGATCTACACAGACCACACATCCTTGAAGACGGCGACTAACTCGCCTCACC
TCTTCCAACGGATGACGAGGTGGCTGTCCTTCTTCGCGGAGTACAACTTCCGCGTCGAGTACAAGCCGGTCATGCTCAACGTGCTTGCGGACGCCCTCTC
TCGGCGTCCTGAATACGAGTTGGCCCACATCAAACGGGTGATAGCGGATCTATATGATCGGATACGCATGGCATATCAGGACGATAAGGCTGTCGCGCCT
ATCGTCACGCTCCTCACGGCACGAACGACCGAAGTCCGACTGGCTTTCGTCGCGACAGCGCTCCCGGCTCCACAGATATGAGTTGAAGAATGGCCTCCTC
TATTACCGGGTGGAGCCCAATGAACCTCCACGGGTGGACGTACCCAACGACGAGGACCCGAAGTTCGATATCCTCGCGGCGGCGCACGGCGCGCCCTTCA
GCGGCCACTTGGGCCGCGAGAAGACCTTCCTGTCGGTCGCTCAGGTCTTCTGGTGGACTAGCATGTACAAGTGGGCCGCCTGATACGCGAAGACATGTGA
AATATGTCAGAGGGTCAAACGCGCAGGGCACTCTTCCGCTCCACCACAGAGCCTAACCTTCCGGCTGAGTGTTGGAAGTCGATGAGTCTTGACTTCATCT
TTGGGCTTCCCGCCGACGGAGACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGATCAAGATGGTACATCTTGCTCCAGCTCCCGTTCCTGTTAC
CGTTACGGGCGAAAAAACCGCAATGTTGTTCATTGATGGCGTGTTCCGCTATCACGGACTCCCGGAGACGACTGGCTTGGATTGAGACCCACGGTTCACG
GCTGCGTTTTGGAAAACGCTGTTTCCTTTACTGGGATTTCGTCTGCAGATGTCCACTGCGGACCATCCACAGACAGACGGTCAGACAAAGCGCGTCGATC
GAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGAAGCACCACGTACGAGGTCGACACAGCTTCCGGTTGTTGAGCTTGCGCTCAACAACGCGGTGCA
CGCGTCCATGGGGGTTCACACCACTCTACTTGAACGGCTTCCGTCACCCCAGAGTGTGTCGCACTCTTCGAGGAGACGCTGACACCTCTATTCTAAGTGG
GGGGTAGGCTCGGAAAGCTCTTTTCTTCCAGGTCTCAGATGTGAGATGTGTTTCGCTGCGGAACTAAATGGAATCTTTTGTGGATACCGTTGTCAGCAGG
GTCCGCGATGTCATGACAGCGGCCCAGGCCAGACAAAAGAAGTACTCTGACAAACATGGAAGAGGAAACTTAAGTGTATTTAAAGTAGAGGACTTAGTGC
TATTAAACACGAGGAACCTACCGCTAGACACTGTCAGATCTGTCGGGAGCAACAAGCTGAAGCACCGCTTCATCGAACCATTCGCAGTCCTGGCCAGGCA
TGGTGCGTCGTACACCATCGACCTGCCTAAGGTAATGACGACGTATATGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCT
GACTCGCAGACCCCCCTTGGCCCATCTCCTCGAAGCGAGGGTCGGCCACAGACGTCGACGAAGGCGTCGGAGCAGGCACCCAAGCCTCGGTTGGAGCGGC
AAGGCTGCGGTCGAAACCGTACGCCGGAGGGGCTCCGTACGAACGGACCCCGGCGCCATACGCCGAGTACGCCGGGTATGCACCATACGCGTACGTCTGG
GAGTGTGCCGCAGGCGGCTCCGGGCGTGGTAGCAGAGCCTCGATCCGTCGGATCGTGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCA
CCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCAACAGCCCTGTGTCGGAGCCGCAGTCGAAGCACTCGGACGAGAGTGACTTTTGGGAGGCGCCGAGTAC
TCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAG
CGACAGCTCCTCGTGAAGTGGAGGGGCTAGGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCGGATTGGCTGCCCGAAGGCTGTCTCAATCT
GGGAGCAGACTGCGGCGACAGCTTCATAAGTTATCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATATCGTACGCGCGCTCATCGTGAGC
GCTGGAAGCCGCGCTTCAGAATGTCCCTTAGCAGCATCCGCTTGCTGACCAAAAGGGCAAACCAGACACAAAGATCACGCTGGTCCAGGATGTGGGCCAG
CAGCTGATCTTCATGGAGTTTCCGTAACTTCGAGGGTGAGTACCTGAAAGACTCCATCCAAGCCCAGAACACGTCCTCACATGAGTTTCAGCTGGGACAG
TTCTTGGGAAGAACCCAGGGGTAGTCCCAGAGAGGGTAGAGACCACCCTGGCTCTCGTGCTTCTTACGACTTATTGTGAAGTCCTTAAGAGGGATACGGT
GTGGCGCGAGAAGCACACACGGAGCCGCCTCCAAGTTGTCGACAAACAACTGCTCCTCCTGGACAAGAGTACGTTCGTAAACGCCCTAGAGGTTTGACCG
CCAACAAGGCCATAAGGAGCGACGTCAAGCTCCAGGAAGAGGTCGGCTCCCGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCT
GGCTGACGGGTGCCGCCACCGAACCCCCACGCGTACGCAGCTTGGAAGTCCTCCTGCTGCTGGTCGAGGTCCTTAGAGATCTCGTGGGCCCAGGAATAGC
ACCCTCTCTCTCTTTCTCCTCTTTCTCGTCCGCTTCATCCGATGAATCGAAGCGGCTACTCAGTCTCCTTCTCCTCGCGGAGTGGAGACTTCGAAGCCGT
ACACTTCTTAGAGGGCTTGGCGCCTTCGGCTTTCGCGGCCTTAACACGCGCAAGACCCTCGTCAAGCGAGAGACGGTTGCGAGGCCTCTCCCTCCTCGTC
GTCGCCAGCTTCGGG