Description :
From Genome Similarity Track
Location :
scaffold_693:3099- 16299
Transcript NameFunction/comments
Pl_102940conserved hypothetical protein
Pl_102941hypothetical protein PHYSODRAFT_349422
Pl_102942hypothetical protein PHYSODRAFT_474392
Pl_102943hypothetical protein PHYSODRAFT_353708
Pl_102944DEAD/DEAH box RNA helicase, putative
Pl_102945hypothetical protein PHYSODRAFT_468573

Sequence
13200 bases(100 bases per row)
ATGCTACAGGAGAGTTTAGGTGGAGGTGGAGAAGTCGCTAGCGCAAGGAGAGCACTGGCTCAAGTTCAGAAATTACTCCATCTAGCTTCAATCAAGCCCA
ATGCATTGACCCTGCGTGAATATCGCGAGGGGTTGGAGGTAGGGACAAAAGCCAACAACCGTTCTCAGATCAGTAATTCTAACTCTATACTTTGGCTGTG
TCTAGGAATGCTTGAATCCAGAATCAAGCGCAGCCATGAAAGCTTCTAACTCTATACTTTGGCTGTGCCTAGGAATGCTTAAATCCAGAATCAAGCGCAG
CCATGAAAGTGCTTGGGTTTCAACTCGCTGGTGTTGCTCCTGGTTGCTCCACGTACGAAGTCTGGAAGTTCATTCTGGAAGCGGTCGTGACTGAACTGGG
TAGTTCGGAGAATACATCAACTCTAGCTGCTGCGATTCCAGTACTAGGCCTTATTCCAATACCTCTCGTCCTCGGATTTTTACTGTCACCGGATAGGGAA
CCCATGAACAAGCTGCGAACAATTTTGACTCATGAGGATATCGAGGTTCGCTGTCGCGCCATCGAGACGTTATCGAGATTAACATTGGGTGTGGCGATCA
ATGTTGCTGGTGACGGATTATTCGTTTTCCCATTCGAGTCACACGAAGCACGAATTTGCTGTCAACAAGATCTGGAGTCGATGGTGAACGACTGCTGGAA
GCTGATCTTCCACACACTTTCCTTTGACGAGCAATCTCAGAGTGCGGTGTGGATTGCAGGCACTGCGTTTACGTCACTATCTAACCTATTTGCAAGAACC
AGCACGATGTCACCGTATTTTCCCAGCATCCGAGAATCAATCCGCGTCCAAGCACCTATAGATGATGTCGCGTCCATGGTATACAAGCAGGCATTTCCGC
GGATCCGAGCACTTATAGTTGCAGCACGGGCACTCCCGATGAAACAGCAGCCAAACACCATACTTTGGATATCTATGTTGCTTTACATGATGATGGAACG
CAGCGGTGCACAGTGTCCAAGCGTCAGTGTACCATACGTGGAAATTGATGCTGAAGATAATGATACCGATGGCGTAGACGACGATGAACCTCAAGCATCA
ACGGAGCCCGTTCGAGTTGATGAGATTGTGAGTGATATGCTCGAATCCTGGGTTTTTCCTACGGTATCAAGACGAGTGTCGTTAGCGCAGGCCACCAGTA
TGTGCCGCGCCATCTTCATTCTATTGAATCATCCGCTGCAGACATTCACACGCATGCGCTGGGCTGCTCAACTCGCCAATCATATCATTGCGCAATGTTA
TCTCGCTAACAAAACTAACAACACCAGCAGCGGCGGTGTTTCGAATCCTGAGCTTAAACTCGATCTTTGCATGATGCTGGTGAAAACATTTGCCTGGTTG
TCCGGTGTAAATTGCCAGTCGCTCTTTGTTCGTACAACCGAAGCGCTCTATCTTCTGGATCAAGAAAAGGACCGACGTGATCTGGTGCAAACTCTCATGG
ACACGATCGCCGTACACATTGTTGCAAACCGAGATTTTCAACTGCTCCAAGGATTGTGTACAATGACGTTCTTCAGACAACCAAAAGGATTCTCCAGGTT
GTCACCACGCACCAACGGCTCTGAGGTGTTCCGAGCGCTTTTTCAAGCTCTCTCAAAAACGTCAGAATTACCCTCAGCTCCTCAAGGAGGAGCTGTTGAG
CGCCAAATATCCCAACTTATTGCCTTGCGGGTGTTTAGAGGGCTACTACTGCTGAAGTTGGGTGGATCAGCCAGTACTTCGCCAAAGGCTTATCGTCGAT
CTTGCGAAATGAGCGAGAATATCGTTTACTACACAGGCTTACTAACATCACACTTTCAGGTCATGCTTTCCTGTCCCGAGCTCGCGCTTCGCGAATCACT
CGACTTTTTCCAACAAGAATTGTTTCCGACCATGGATCAGATTGCGTCCCAATGTGCTCGCCTCCAGATACTTTGGGTTGGCGTGCGTCTTCATCGGAAT
TACGCGTCTCATGTACCATTTGATTCTTTAGTGCGAGAACTTCAGCGTGAGACTGGCCGATTGTTCACTGCCATCTGGAATGACGACGACGAGATGGAAG
GCGCAACTTTTGATAACGGACTGCTAGGATGTGGTGGTGAGAGTGTAGAAGACACACCTGCAAGTCGTAAGCGTGCGGGCGATGTCAACAATGTCGACGC
ATTGATGGTGATCGGCGATTGTATTACGCTGTTAGCACAACTTCAGCCCCACACTCAGCCTCTGTTTCTCCAGATGTGCGAAAAGATGATTGCAACTCTA
TCAGCGTCAGGGAGTTCTCCAGCGATAGCATCCCAGCAGTATCGCGTGTACGTTGACGGGATCTGTCCCCACTTGTCCAATTTTTAAAGAACTTTGGCTA
ATCACACTATTGTTTATGCAGTATTGAGGATGCTATGACACTCCTGTCGACCCCTGTACCTGCCAATGCAGTACCGGAAGCTGAGGCTCAGTCTTCAAAA
GAGATTTTTGACCCACAGGACATATTTCTCCCGCGAAAATATTTCGATGAACATGGAAAAACAGGTCACCTCGAAAAATCGCAAGACGATGATTATCGCG
AACCAATCACCATTACGGGTAGTGCTGACCCTGTTTCCGTTCGGATCTCCCACCACCACCCGCTCACCGGAAAAGAAGAGGTAGTCTCCCTTGACATCAG
TTGCTGCAACCTCACTACTTGGCCGCTGAGTGATTTGGAAATTCATCTTCGTCCTTTAGGAGGTGTCGGAGTTGTTCAGTGTGTGGACGCTTCTAAGGAC
TTGAAACTGCGTTTGCTACGTACTAGTGAGACCGTCAGCGTTGGTACTAGTGGAGGTAGTACCAGCTTACCACCTTTTGGCGTGATCAAAGCGCAAAAGC
GGTTTCGAGTTTGTAAATTTACTCAGGCCACTTTTCTCGTACAAGCAGTGCTTGTCCAGGAACTTAGTCAATGCGGCGACGATATGGGCGGAAATCCTGC
AGAGGAAGTACCTCCAGCTCCAGTCCGCTTGGCATTCAGTAACCAATACGTGCTCCATTTTGATGCGCTGCTTCGACTGCCTCAGCCTCAATTCACGACC
GGTGCATTCTTCCAACACTGCTGGCAGAGGTACAACACAGTCGCTGTTAGTGATGTCAATCTTGTCTGGGCTAATTACTATTGTGTTTCTGTTGTAGCGC
CAATTCAGGCGTTTTGTGGCGCGTAAAATCGCAGGATTCACAAAGTGATAAACTTGGTGTCTGCCAGTGCACTGTCCACAACTTGAATACGAACATCGCA
TCTGTTGCCGAGCTGCTAATGGATCTACCAATGCACTTTCATGTAAGTGACTAATCACCAATTCCGTAGTCCATGTGATTATGCATTTACCCATATCTCA
ATGTGATCGTTTAGACCGCGATGCTCACTCAGACGAGGTGGGGTTCCTATGTGGTTGCGTCTTTGACGATGAGTCTCGAGTCGGATTCAAGCTGGTCAGG
TATGCTAGAAGTCCGGTCAACTCGTGACAACATCCGCGAATTCGAGAAGTGGCCGAAGGATACTGTTCGTCTTTTCAGTGGAGATCACGTACAGCTCAGC
AGTACACTCGCGACACCATCAATTGCTCGTCAACCATCCAGTCAAACTAACGACCTCAACAACACAGTCGATACCCAAAACCCCTTATCCACCCCTCCAT
CTGCATTCGACAACAAATTCTCTGGTCAAGTCCCTGTAATGGAACCGATCACTGCTGAAAACGGAGCATCTGCGGGATGGCCAATCGAACCAGCCCGAGT
TACCACTTCGACCTTCGCTCCGGACGTGCGCTCCACCACAAGCTTCCACAAGGACATCAGCATCCCCACCGACCGTATGTCTTCCTTCGCTCGGACCAGT
CAACAACAGGATCAAACTCGAACAGCCGAGATCACTCCATCTGACGAGCAATGGGGCAGCTTCCTTTAGCTAGACAAGTTGAAGTCAACTTCAACTTGAT
GTATTTCACACCTACTTCGATGGTCGTAAGACCTCAACCCACTTCTCATTGGCTAAAATCCTTGTAAAATCATTTTGTCATCAGATCCAAGATGCGGCCA
CTAGACCGACAGCGCGGGGCTTCTGGCGTGGCTCTGGGCGACGAGGATGCAGAGGAAGAGCGTGTATATCGTCCGCTCTTGTTCCAGTCCACGGGATACG
CGTCCTCGGAGCTTTTTCGCGACTCGTATGAGATGCACTCGCGTCTTCCGACCGTGTCATCGACCGCGCCTCTATTAGGGGTAGAGACTACTGTCACCGA
CTCAGATGGGAATCAGAAACAGAGACATGTATTCGAACCACAGATTCGACTGGAGACACTATCGTCTCGAGCAGCTACAGCAGTGCTCTGGATCACGTAC
TTGGCATTCTTATTGGCCATGGCACTACCGTATCTACAGAGCAAAGGATATCTGGAAACGGTGGGAAAATGAGTAGCATCAGATCTGAGGAAAGATACTA
ATGTCTGATTCTGCACTTCAACTAGGCGGTGGAGTTATCAGGATCAGTTTGTAAGGATAACATGAGGAGAGAACCATGTATTGAAGTGGACAAGAGCAGG
AATATCGCTCGGTGGGCAGCCTATGTAGCCAATGTGTCGAGATATACTGGCTCTATTGAGATCAAACTTGATGTCCGGGAACAGGTGAACTCTTCAACGT
TAGCAGAATTGCTATCATCATCGGAGAGCAATACGTTCCAGGAGTTAGAACATGTGGGAACTGCATGGACAATGGATCGAGATGCAAACCGGGTGATGAA
CAATTTAGCTGACGAGACAGCGAGTGTCTCTGAGGTTGAAGATGGAGTAGTTGACAAAGACATTGGCTATGTGCTGACCTATGATGCCAGACTATACGGT
ATTGATCACGATGTGGCGCCGGTTACGAAGGAACTCATTGTTGACGAACACAATCAGAGCGTTTGGGTAGAATGCCGATCTGGAGGACCATGTGAAGCAG
TGAGGCTGCTGGAGATTACACAGGACGTCGACAAATTGGTAAGAGTAGATATGCTGATCAGATGTTATAAACTAAGTTCGCGATATGCATTCACGTGTTG
TACTAATTTTCGATGCATCCTTTTAACAGGGTGGAAGTGGATACGATGCGTACTTTGCTGTGGTGACTTTCAGAGGGCTTTATTACAGGGTGGAAGTGGA
TACAATGCGTACTCTGCTGTGGTGACTTTCAGAGGGCTTTATCCGAATGTGTTCGGCAAAATCGTGGTGTATCAATTCGCATATACGTACGTTCATTTTT
CTAGTGGCTATTCGTTCACATGGTCAATCTAAGTTTTATAATTGTTTGCTTTCCACGTTTCGTTCTTCAGAAAACCAGCTATTCACGTTGGCGAAGTCGT
TGTTCGTGGAGTACTGGTGTTGGCGTCAATTCTAGCACTTCCTTGCTGGTTCATTTCGGTGCTAAATTTTCACGGTAGATGGAGTCAAGTGCTTACCGTG
CAAAAGTGGCTGCTAGGTGTTGGTGTCGTGCTGGTGCTTTGGCAGAATCCTGTTTACGCAGTGTCTGAACTGTACACTACCGTAAGTATGCGTACCCGGT
TTGTGTCGATCACGTGTCAGTCATTTGCAGAAGCTTTTTTCTACGTGTTTTGGTTGAGTCTTATGGACCAGCACAGTGGAGATTTCTCCTCTCGAAGATG
CTCACTTGCTACTAAGTTCATATTTGGATTGGTGCTTTTCGCTGTGGACACAAGTATGACTGTGTTACGAATGCCCAAATTGTTTTTCGGTGTAGAAGGA
ACGTCATCCGCGCATGACTTCCACCACAAGGAGCTTTATGCACTTCTTGGCTTTATTCGGACGGGTTTGGTGCTATCTTGGCTCGTGTGGATCATGGTAG
TTGGAGCGCGATCAGGCCGTTATCTGAAGACACTACCGTACATGGCGACGCGCTTCAAGCAACTATCATATCGATTTCTTGTGCTCGAGACGCTTCTTAT
TTTCATCTACGTGTTTGTACTCTCAGCTCTCCAGATATTTTACCTGACTCAAACGTGGTACTTCGTTGGCTACGATGCATTCATCCAGGATTCAGTGCAC
ACATTTGCTAAGATGCACACTGGCCACCCGTCGCTGGGCAAATTCTTATTCTTGTCGATATATGTGTACCTTGTGATGTTTGTGCACCTGCCACCTCTTG
CAGGAGACAGCACAGGGTTGCTGGCGTCCACAGCTTTTCACGTCGATGAGAAGCCACGGGTGGATTCTTACGGCTTCCTCACGCCCGATTCAAACCTGTT
CTGTGTGGAATCGGCTGGATGGCTGCTGGAGTTAGCGTATCAGGCTTACTTTGATCCACCTGGATGTCCATCATCGTCTGGGTATGGCGAACTCAATCTT
GAGCGCTATGGGTTTGAGCTTATCACTCATCTACGAAGCAACCTAACAGATACACACGTAGTCGTCGCATGGAGTCAAGAGGACCACCGGCGCTTGGTTA
TATCGTTCCGAGGAACCACAAGCAAGGAAAACTGGAAAAGTAATCTACGAGCTGACCAAAAAGTACTATGGATAAAATCTAGAGGGCTTCGCTGGAGGAA
ATCTTGTCTTGAAAAGTTGAAGGACGTTGCAGCGAAGATCCCCTTGCTTAACATGGCGCTGCCGCGGGTGCATCGAGGTAATTATTTGTCGCGTTGGCTA
TTATATCAATAATTGTCTGATGCTTTTGCTGTTGTTGCCCAGGCTTTTGGATTGCATACGAGTCAATTCGAGATGAGCTTAAGGAGGTGACACGGCTCAT
TCTGGACGAAAACCCTGGTGTGTCAGTGTACATCACCGGTCACAGCATGGGTGGTGCGCTTGCGGTTATTGCTGCGTATGATCTTGCCGTGAATTTTAGC
ATCAAAGTCAACATGTATAACTTCGGTGGACCTCGCGTTGGCAATCCAAGCTTCCGCCAGCACTATGATAGCTGCGTTCCTACGAGTTACCGAGTTGTCA
TGGACGGTGATATCGTACCAGGCTGGCCGAAATTTGTACGTACGCGTGCCTTGATGTTGCAGAAACATTTGACTAACGTCACCTTGCTATGTGCTTTTCA
ATTAACTACCAGTGGGGACTGTACCAGCATGTGGGAACTGAAATCTCACTTGACATTGCGGGCAACCTGATTGTTGACCCAAGCTTCGTGGAGCGCCATC
TCCACAACTCGTCAAGGCGCAAGACAACAATGCATGGTACAAACGTGTACCGTGTATCGATCGCCAAATGTCTCGAGAATCTTACCTCATCGTAACAAGC
TTGCGAAGTCATCACACCTGTACACCAATCTATCTATTTGAACTACTTGCTATTGTCCAGACCAAGCAAGGCATTTACCATGAAGCGTCGCAATCCGTTT
CAGATGGAGTCCTTGCTAGTGCCAACGAGCAAGTAGGATCGCTACCCTTAGGTAAGAGGTAAACGCAAACGCGATGTCGGACACAGAGGATCAGCAAGCC
CAAGAAGGGATAATTCGCTCGCACATCGACCTTGCTGAAGCAGCGGCTAACGGCTCCCGTACAATGGTACGTACTTGTTGATACTGCGCTATGCTGATGA
TGAAGCTCTCTCTAACAGTGATCTTGCATTCACTGCATTAGGTTGATTTTCTGCTTGACAATGGTGTGCACATCAATACACCTGGAAAAGGTTGATTCTA
CAGTACTTATGAAGAGCAGATTTACGTCACTGACAAGATCTCTTCATTCGTAAACTGTCAGATGGAACGACGCCACTATGTGCTGCAGCTCTATGGGGAA
ATGACACAATGGTTACGTACTTACTCGACAAAGGCGCAGACGTGTCTGCCAGAAACGAAGGTATGTTGGTTATATTTCTTCTCAAATGCTGTTGTTAAGT
GTGCTGAAAAGCAATTGAATGAATAATTCCATCGCTTTAAACAGGAACGGGGTGGACAGCTCTACATGCGGCCTCATTTCAGGAGCACGGTAAGGTCGTA
CGCATTTTGTTGAGCCACCAAGCAGATCCAAAACTAGTCGACGTGGAAGGGCGAAGATCTGTAGACTACGCCAGCATCTCCGAGGCTATTTGGCCCTTCT
TCTCTAGTAAGGCACTCTATGAAGGGTGTGTCTTCTGAGCTGCATTCTGATAGTGCTCACCGCTTTCCTTCAGCGCAAGGCTGCACCAAGAGTCTTAAGT
CGGATCTAGTCGCGAAAGGGATCATTCGCAAAATCCCAGATCAGCCTGAGCAACCTCAGCCGAACGATAAATTCACGGAGAGCGTACGTCTTGTGTAGTG
ACATTTACGGCTGTGCGGATGTCTAACCCCTCGCTGTGTTTACTACGACAGATATCGGCATTCTCCCGCCCTGGATCTGCCTATACGAGGGCACAGATGT
ACCCGCCACTAGCTCGCCGACAGAGCCCCGCAATCAAAGTAGGACCATGCAGTTATAGCTTCGATTCATCAGCCATTGACACTTTATGTTGGACTGCAGT
CGCGCGATGGTCGAATCGTGACGGGACCCATCGATCCGCTCGGCGATATACCATCCGAGCCCGAATCGAACCAGCGACGCCCGTCCTTAAAGAGATTGGG
CATTTAACCTGCATCAGAACCACCTTTGCGAGGACTGTGGTCTGAGCAAGTTGCCGTCGTTGAAGTGCACTGAAGTAACACTCCATTTGCAATGGCTACA
TGTACTCTTAAGTAAAAAAAGCGCATAAAAAAGAGTACATCCTATGAAGTGGTGCACACCATGGCGCTATAGAAAAGAGGCCTTTCCCTCGTAGCCGCTC
GTTTGGAGCCCCCCTGACCTCAGTTCTTGTATCGCTTGACCGCCAGCACACCGCTCAACAATGGTGAGTCCTGTACCGCCGGAAGGAAGCCTCAAAGGAC
AGCGACACTAACTTCTTTCATGCCGACAGTCGCTTCTTAACAAGGGATCACGTGTCTTGACCCAGTCGCTCCGCGCTGGTGCTCGCAACATGTCCAGTGC
CACGGAGCACGAGGCCAAGGAGCAGATGCACCGATGGAAAACCATCTCGGCGGGCATGATCGGCCTGGTCGGAGTGTACACGGTGTACGCTATCAGCGAC
CACCTGAGCCACGAGCACCACGAGGAGGAGACGCCTGCTTACCCGTACCTCAAGATGCGCACCAAGCCGTTCCCGTGGCCCGAGTCGAACTGCGACCTCC
TGGACTTTGACTGCCGTAGCAAGGCCCGTGAGGCCAAGAAGGCTCTGGAGTAAACAGTGCAACTGCAGGACATACAGGACAGGTGCTGAAGCAAGGGTAA
CTTCTCTCGCATCTGACCTCCTTTCTGCTGTCACTTCATGTTCGCTCGGACTTTTAACCTCCACATAATCAACTGAAAAAGAAAGAAACACACGAAACAG
AGTCTTCGTCCTTCAGCGAGTGTCTGCATCTCGATAGTGTCTCTCCATTTTCAGCTTGACCGTTTAGAAGTAGCAGAAATGAAGTAACATCTGGGTGGAC
CACCCGAACACCACAGTTACTTTATCCATCGACCTGATGGACACCTCAATTGTCGAGTGCAGCGTGGCTCAACGCCAGCCGCAACCTGGTGAACCTGCGT
GCGTGGTACGTCACGTGCTTACATACAATTAAATAAATATTAATGCAATATTGTATTGCACTTGCAGGTGTGCGGTCGCTATGGCGAGTATGTGTGCGAC
GCCACAGACGAAGACGTGTGCAGTGTCCAATGCCGCGATGTCTGCATATCTAGACACCAGCAGAAACGTCAAAAGGATGCACACTTGGTCAAGAATTCTG
AAGAACTTCGGCGGAAACTGGGCATTCAAATCTCATTTGAATCCACTGCTAAGACTGTTGCGAGTGGAAATGGGCAATTTCCGATTCCATTCGTCGACTT
TGCACAAGAGCAGAAAAGTACGCAGTTACCAAACAAACTGTTGATAAATCTCAGTGCCAATGGCTTTGAGAGACCGACACCTGTACAGATGCAGACGATC
CCTTGTGTGTTGCAGGGGCACAATGTACGTGAGTTAATAGACGATAGGAAGATTGCTGCGACTTACGTGGAGGTGAATATTTGACTTTAGGTGCTGGTGA
GTGCTCCAACTGGAACAGGTAAAACAGCATCGTACCTGATTCCTACGATCGCACAGATTTTACTTGCACGGGGTGAGCAGAAGGAGAGTATTGTGTTGGT
GTTGGTTCCTGTTCGAGAGCTGGCAATTCAGATTGAGTCTGTGGCTAAGTCATTGATGCGAGGTATTGCTGATATGAAGACGGCATTATTGGTCGGAGGG
TTCCCTATTCCTACGCAGCGCTACCGTCTTCAAAGTGGAGTTCAGATTATTGTAGCAACACCTGGCCGGTTTCTCGATATTTTTACAAACTACAGCGGTA
GTGATGCCATTTTGCCGGTGATTCGCACGTGTGTGATTGATGAAGTGGATACGATGCTGGACGTTGGCTTTCGACCACAGATATCTCAGATTGTGGCGCT
GTTGGTTGATTTATCCCAAGAAGGCATCCAGTTACTGTTTTTCAGCGCAACAATTTCAGATGAGGTCGAAACACTGGTTCAGCAGGTTTTGAAAGTACAA
AGCAAACAAATATACCTTCGCATTGACGTGCGCAACGAAACTAAGGGAAATGCGAGCTTTTCGCTGAATTCAAGCGTGAAGCACGTGGTTCGATGGTCTG
AAGACAAGGCGAAAAAGAACGAGCTGTTTGATTTTTTAAAAGGGAAAGGCGAGGAATCCACGGTGCGTGCACGTTGGTGACCTGTGGTGTTGTAAACACT
TTTTTTTTCTTACGGATATGATCGTGTGCTGTGTAGCTTGTATTTGTTGGGTCAAAAGTTGGTGCTACGATGCTTGCAAAAGCGATTGAAAAGCACAGTG
GGATCGGTGCAGCGGCCATCCACGGAGATAAATCCCAGCAAGAAAGACTTAAGCTACTGGAAGCCTTTGTGAACTTGGAGATTCCTGTCCTCGTGTCCAC
AAACGTGCTGAGTCGTGGAATGGATCTCTTGAACGTTGAAAATGTGGTAATATATGACTTCCCCAAGAAAATTGCAGACTACGTTCATCTTATTGGCCGT
ACCGGACGTGGTGATGTGATCGGGAATGCTCTTACACTCGTGAACATGGAAAATCGCTTATTTTTCCGCGAACTCGTTCCATTGTTGCGCCAAGCTAAAA
TTTCAGTACCTCGACAAGTGTACCAGACAGTTCATTCAGATGATACTAGTAAGCGCGTTCGCTCCACTGAAGGTATGGTAGATGAATCTAAGCGTGCTTT
CCGTATTCGAAAGCTACCGATTGACGAAATAGGTTCGCAGGTTTCGGAGTGGAAGGAATGGGAGAATCGCAAGAGTAAGCGGCGGAAGGAAGGGTCATAA
TCGCCAACAGCAAACTCGTTAGCGCTGAATTAGCTGGCAAACTAAAGTCAAGATCTTTGATGGCCGTGTTTCAATGAGGGTGTATTGCACCTAGCACCGA
GAACGTGGGGCTACGGTTGTTAGCAATCACAGCTGGAGCAATCTGGTTTCGACGTTGGTCACAGTCCCTTGACATATTTTGGGTTGTTTTTTTCGCGCTA
GTTCGTGAGCGGCGACACTTGTCTTTTGGGATATAGTTATTGTAGCACACAGCACCTCGGATAATTGCGACCTCAGCATTTGATACCATGGCAAGGCGCC
ATATCAGACGTGGACACCTCAGCGAAAGAGTCACAACTCGGCTGAAGTAAAATGGCATGGCACGGACCACCAGTGGATGGTCCCATTAAAAACTCCTTGG
AAAATGACAACATCCTCGAACGTCGTCTCCACCAAAAAACACTCGGCACATGATTATTATGTGGGCTAGAAGTAACAGCACCACTACAGGAGCTGCAAAG
CTTATTCGAAACCGCAATTTGTTCCTTATGACTGGAGTGAGGGCATCGAGTGTGAGTGCCCACAGAAACCAGACCTCCCATGTGAGTGCCATGATACAAC
GAGATAGTTCCCATTTGCTCAAGATGCATACACTCAGGTTGGCGGCAGTAACTTGAAATACGTAGAATATACTGTCAAATGAGGTGACAAGTACCTTGAG
AAGCTGCCGCTGATAAAGAGCGATAAACGGAATTACGAAGGCCAATGTCCATAGTAATGCACTCCACGCTTCAACGAGTGAGAGAGTGCGGTTAGTCGCG
TTTAAGCTGCCCAGAAAAACGGAGCACGAAAGGAGGAGACCGAGAGCACCCATAACATAAAGTGGTAGCAGGTACCATGATGAAAAAGGATCTTCTGATA
CTCGCAGCGAAAAAACTGTGTGGCTTGCGTTGAATGCCTGGGAAGACTTGACGAACTTCATCTTCTGCATGACGTTCGTCTCCCGCAGCATCACTTTCCT
CGCTGTTTTCGTGCCTACAGCTCGGCGACGAGCAACAGGTCTACCTGTCTGGGTTTTGGTGAAAGGTGCAATTGGAGTGCGTTGTATTTGCACTAACTGC
AGAGCGCATGTGTAGATGACACATTGAATGGATGATGAATTCCGGCTTATCCGCAACACTCGTCGCTTCCTCAGAGCAATCTTAGTGATGAACAATGCAA
GCGTCAATAATCCATTCCCAATCACGTCAACACCGGAGAGATGGAAGCTGTGGTGCTCATTTTCGTAGTTTAAGATTGAAAAGGAGGTGCACCCGTCAAC
ATGCCCCAACATGATCCAGATCAGCATGAATAGCACCGGTGGAATCCCAACGATAGTCATGAGTGCAAATTGATGAACTCCTCTGACATGAGCGTCGATA
CAAACGATATGGTGGAACCCCACCCAATCGATGACCATTCGAAGGAATCGCAAATCTCGGAAATACACGGACACCATTGCAGCTGTCATACTTGTGACGA
AGGAGAAGAACCAGAAATCAAATGTCCCCAAAAGCAGCCGTACGACATCATATCGTAGCGTGCTAAAGGCTCCTAAACCGAGCGGCACCCAAAGGAAATG
CTGATCAGTGATAGGAATTGTCCTGTCCTCGCATTTACGACAGCTACGAAACTGATCAGCACAAATGCTGTCACATTTGCTAGCAACAACGGCTGATGGT
ATTTGGTGAGGATCCGACGGCTAATATCGTGAATTTTTGGTGGGAGGAATTCTCCTCTGAGGGACTTGGACAGATCGACCACAGGAAGCGGCTTCGCTGG