Description :
From Genome Similarity Track
Location :
Scaffold_30:30988- 52133
Transcript NameFunction/comments
Physo_134100hypothetical protein
Physo_156832hypothetical protein
Physo_134101hypothetical protein
Physo_134102hypothetical protein
Physo_108750amidophosphoribosyltransferase

Sequence
21145 bases(100 bases per row)
GATTGCTCGAGCAGAGTGACGCAGCAGTTGGAGCTGGCGGTGGAGTTCCCAGAACCAAGGAGTTGCCACTCAGAACAATTCACGCGCTTGCTGCTGGGCC
ATGTAAACACCTCCGTCACGCTGCTACTTGCCGACAAAAAATCCGAGGTGCGAATGCTGAGTTTCATGCTTTCAGCGTAACATATGAGTCTAACGTCGTT
ATTGCTACCACCCTTTTAGGCCATCTTACAAGTTGCGGATAACACTTTATCTCGCTGGATCGATCATCTGCGAAGACTACCTGGCCAAAACCCAAAGCTG
GCGTCGTCTTTCAGTGACCGAACGTTTCGGATATTGTGGAAATGTGCAGCTGCCGCGGACGGCGTCAAACAAAAGTCGGCCGAAACAGCCAGTGCAGCCC
TCCGCTTCCGTTCAACAGCATTGCTATTCCTGCTGAAATGCTCCAATTACACTGCTTCGTACTTCATCCAACAGGTAATAGGTGGCACGCTTGCAAGACA
ATAGTGAGCGAGGCGACCAGTTTCTTACTTCTTGATGAATCCCATACTTAGGTACATCGCGTTGGGGTTCAACACGAACGCGCTACCAAAAGATCTCAAC
TGGGGCTTCAAGAAGTGTACGCGTTTTATGCTCGAGAAGCGACCGCATTGTTTCAAACCGTTCCTGATGCGCCACACATGTACACTGTGCGTGTAGTGAT
TGTTAATGTGGATATATGCGCTGGTTTACTAATTGTGTTATCGTTTAACCCTACGATTTTGTGATGCGGCAGTCAGAATCGCTCCAGTGGGAGTACGTGA
ACTGGTTCGAGCACTTCGCTACGGTTTGTGACTTGTCCGGAATGCACTTGAAGAGCGCGATGATTCTGAAAAGTGTGGTCCATTATGTTAAGCAATTTGG
AAGCAAGGGGGCCTCCATTCAAGCGTGCCTCCTTTATTCGATTGCGGGTGCGCTTTTTAGTGCAGCCGATTCTTCAAAAGAAGGAGTATGCCATTCATCA
GAAAGTGGGCGTGTTAGCGCTGCCTTTGATGAAAGGTTAATGTCTTGCACCGGAAAACGTTTTCAGGATCTCTTCGACAACACCAAGCCCAGCGAGTGGC
TTGATCATTGTGAAAAGGCAGCGCGGGTGTATTTGAAAAAACTCGAGTCGTTGGCGCCTTACAGTTTTGTTGGCTTGGGCTCGCAAGATCACGGCTTGTT
TCTGGCGCGTTGTATTAAAAGAAGCTCGACTAAGGTATTTAACTATGCTATCAGTGTTCGACATTCTCAGAAAACCCAGTTATACAGACAAGACATCATG
TGGTAAGTGCCTTGCACATTCTTCGTCGGCGTAATTCATATCGTCGGTCTAACCTGATGTTGCAGCTTTGGGAACATGTGCAAGGCGTTGACAGGGCTTC
GCTCCTCTCCGACCCTTACAGATATCAAGACCATTGAAACTTTGATCCTAGATGAATCAAGGCTTCACCGAATGGCTGTGATGCTCTCGGTGCGATGTTG
CAGGACGATGAGCTTTGACGCAGCCAAACCCGTACTGCACACGATGTCACAGCATGTGAAATTAGTCCGTGAACTACTGGATTACACAATGATGGATGGG
AAGCCGAGCGAATCAATTCTCCAAGGAATCCTTGGTGATCTGAACTCAATTGCCCGAGAATGCTATGCCTGTGCTTCAAGCTGCTATAAGGCAGGGATGT
ACCACGATACGATTTCAGCTCTGGTCGGCGCATTCGAGCTCGCCGAAAGCTACTTGGAGTACGTTATGTGCAGCAAGCTCAGCATTGAAGACATCCACAA
GGCGCACGTGCATCTCAAAGTTGATGCAATTGCCTCTTTGCTGGCCCACTGCTTCCGCGAAGTGGGTGATGTTACGAAATCGCGGGAATTCAATGGGTTC
TCACTATTGTATTGTGGAGATATTTCCGAGAAGATCCCGCAAGCAAGTGTTGACAAGTACGTGTCCTGCATCCTAGAAGAACCAACATCTTCGGACGTTG
ATATGAAATTCTGTATGGCTGATGTGTTCAAAGCGTTTGTCGATAACGCAACTCATGTGTATAAATCTCGCCACATCCCGGAGGACCAGATTTTACGACT
TTGGCGTTCATTTCGATCCGCCTTCGAGCGAATGTCTGCCAAGATTGTGATGAATTTGCGAGCAAGTGCAAGCGATGTACCTGATCTTCCATCCTACGAT
ACTGTGGAATTATGTTGTACGATTGAGAGCCATTTAGATGGTGTTTTGATGGGACGTGCGAAGAATTCCAACGAGTGCTGTGATATTCTCCTTGAAATCG
CACATACTTTGGCAAATCGCAAGCTGCTTTTCTGTGCCTACTACACGAAACACGACTTCAACAGTTTAATCGAGGGGCTTCTACACACGCATCGTTCTTT
GGGTGCTGCTGCTGAAAAACTCGAAGGTTTTACCAGTAGAGCAGACTTTGATATCGGAGGTGTTTACGGATGGCGTGGCGTGATCACCCTGGAGATGGCT
CTCATTTATAGCTACGCTGGTACTTCTCATTGTTGTGACGCCGTTGGGGATATTGAAATCAGCGAAAGGAGTGCAATTATGGATATTGAGAAGTGCCTGC
ACTACTGGCGGGTTGGCGAAAACGCATTCGGTTGCCTGTTTGACGAACCCCACGTGATTACTTGCTTGGAATCCGTCTGCAATACGCTGTCGTTGGCGTC
GTGCTCTGCAACAGAGAATGCGGCTAGACACTTGCTGAAGACGTTTGAGGTGTCCGAGATGAAAGGTACTACATTAGGATGTATCCCGTCCCCCTTGTTA
CGTGTGTTTGGAACTGTAGCCAGCAAAAACGCATTGGTAGAAGAACCGCAAGTGATCGGTATGCAAGGGGCTAACAACAACGAAGAAGTACAGGGGTTCG
AGCAAGTCGACCTAGCGATCTCTGCTGCAAGGAGATCTCACTGTGATGAAAACACAGTCCAAGCTTGCCGACAGTTGCGAGATGCAGTTGCTATGCTGGG
TGCGCTAAAAGCAACTACAAAGCAACGCTCGACAGCGACGGTGGTAAAGGCGCTTGGACTGAGGGAGATGCTAGTTCACACGATTCTATCGGATATCCAT
TTTCGTGAGGGGCGAAGTACTGGCGCTATCATTGAAGCTAAGTCAGCGCTCCGGATTTGCTGGAAAATGGCGAAAAGGTTCACTGCTGCATCGTCGACTG
TTGAAGCTGCGTACTTTGACCTGCCTTCTGAGTTATCAGCAACCGACTGGCAACACCGAAAATCGGCGCATCTTTATTTTATGGCCCTAGAAAGCTCGTC
ATGGGATGTGTTGTATGCTGCGAAGGTGTCGTTGTGTCGAATAGCATCCCTCTACTGCTATTCAGACCAGCCTCACAGAGCTGCATCGTATTTGACTGAG
GCGATGCGGCTTGTGGGTGGATTGAATCTGCATTTGTTTCGTCGAACCCCATTTTACGAATTCGCAGAATTGGAGCTAAATGCGAGTCACTTGGAAAAGG
CAAAAACAGCAATATCGATGTTGTCGTCGAATTCGAGGATGGAACCGGTAATTCAAGATCTTGATATCAGTGGTTTAAGACCGAAGCATCATCCCTGTGC
TCACACCGACTGGGCGTTCACAGAGCAAATGTGCAACGAAATGGTACAGCGAGGAGACGTGCACGTCATTGAAGGGGATAGACAGAAAGCACTGCGCTGT
TACTTGGAAGCGATCGAGACATTGTCCGCGGTTGAAAATGGAGAAGTATCTGAGTCCAGCGCGTTGGCAATGGTCAATGCTCGTTGTTGGCGGAAGTATA
CACGCCATCACAGCGAGATCATCGATTTATCTGACACAAGTGCAGTGGAAACACTGCTAAACTCGATGAAAACACTTAAACGAACGTTGAAGCGCTGTGG
TGCACGATTGGAACGGGTTAAGTGCATGCTGGAATTAGGGCGCATAAACATCAAGCTGCTACGCTCGTCCTCATGTCGGGCGTTTGCAAGTCTGGAGCGG
ACGATCTCTTTACTAGAAGAAGCCTACTCGCTTGGCGACTGTCTTGGCATTGCTCACTTAAGTCAAGAACTGCGGGCAACTTTGGGAATGGCGTATTTTG
CTGAAATCGAGGAAAGTGCCCACGGCGATGCAGATCGAATGGACGGTGACAGAGCGCGGTTTCTTTCATGGTCTAGCAGTGCACTGTTAGCGAATAGTTG
CAGCAGTACCGAATGCGAAATGGTGTCAGCAGAACCTACCGATTCGGATGCAGAATTATCATCGAAGGAGGCTCTGATGAATCAGCTTGAGCAATTGTCA
GCTCGTCCAGGCGCAGATCAAACTTATTCAATTCGCAAACAGGTTGAGGACATGACCCAGAGCCTTTCTGAGAAGGTCCACGAGCTACCCAGCTCCTGGG
TCATCGTGTCCTTGATGATGGGTCTGTCGTCTGAACTTGTGGTTACTCGTTTTACGGTACGTATTCCTCGTTCTATTGGTAGATTGACAGTATGCTAACA
TCGTGATATGCGCAGACAAATGGCACTGCCCCGATCTCGTTTTGTCTGCCCAACGTTTCTTGGAAATCGTGTATAGACAAGATGGATGCCATCGTCGAGA
AGTCAAGGTGCGCTACTGTTGGTGTGACTGATCTCTCGCGAGGATCTGACGTTGTGTGTATGGCGGACAGGGAAATCCTGTCGGGCCACACGGCCGAAGA
GGCAGGCTCTTGGAGCACAAAGCAAAAAAAGGAGTGGTGGGATACCCGTAAGCAACTTGACGAGCGCATTCAGAAATCAGTCCGTTCAATGGAGGTGCGG
AGAAAACGAATGTGTGCTGACAAGATAGTAGTGCAAGTACTTACAAAAATCATGCTGTGCTGTGTAGATGACGCTTGGATTTTGGCGATGCTTGCTCGTA
AAAGGAACAAGCACACTTGAAACGCAGTGCGTTCAGCAGTGTTGGAGTTTGCTTACCTCGAGGAAAGTATGCCCCGTCCTGCTGGCTGAGAGGAATCAAA
GCTTGCTATGTGCAATCGCTGATGCGCAACAATGGTTGTCGGACGGTGAAGTGGTGAACGGATTAAAGCACATTGCTGCAGAAATTGATGTGCCCCTATC
CGATTCTGGGTTACAGGAAGCCCTTCAGTTATTGCGGAAGCTGGGGCAACAATCTGGGTTAAGCCCGTCACGAGCGACTCACTCAAGCTACCTACCAAAG
CTAAGGACGGATAAAATCCAGAAGATGAAAGTGAGCGAGCTGAAACAACTTCTCGCTGCTGAAGGACTTAGCACTGACGGTCTGAAAAAGGTGCTGGTTG
AGCGGCTCATAGCTGCGCGCGATGCAGCACTTTTGGAGCCTTTGACCGATCAAGCTGCGCGCGATCAAGGCTTTTCGACTATCTTGATATTGAATCACCA
GCTGCAGCAATTTCCGTGGGAAGGAATGGACATCATGGGAAGGAGCAGTGGCGTAACCCGAATGCCTTCTCTCGATCTGACCATGCAGAACGCAAGATAC
GTAATGCAGTCACGAACGTCTAGCTACTCCTCGATTCGACGGGATCGCGTGCGCTTTCTTCTGAATCCTGCTGGAGACCTCAAAGCGACACAAAATCAGC
TGGGGCCTGTTTTAGAAGGCGGAGTGACGACCTACGGATGGGAAGGTATTGTTGGGGAAGCTCCAGATCCTGACAAACTGAGGTAAGCGTCTCAAAAATG
GCGGTGCGCATGGAGATGACTTTTCTAACTTCTTTTACGTTGCTGCGTATGCAATGTTGCCAACCGCAGAAACTATTTATTGGCCGCCGATCTGTATATT
TATTGTGGCCACGGCTCGGGCGAGGCGTACTTGCATCGCGACCAAGTGCTCAGTCTGAAGTCCGGTTGCAGCGCCGCCCTGTTGTTTGGCTGCAGCAGCG
GGCGACTCAAGCGAGAGGGTATCTTCGGCCCGAGTGGCGCTGTGCTGGCTTACTTGCGAGCTGGCAGCCCGGCGGTGCTGGCGATGCTCTGGGACGTCAC
GGACCGGGACATCGACCAACTGAGCGTCAAGATTCTGCGGGAGTGGCTTCTGAGCGAGGACGGCGACTCGAGCCCATCGCTCGCACGAGTGCTGCAGGAC
TCGCGAAGCGTGTGCAAGCTCAAGTATCTGAACGGCCACGCTGCCGTGTGCTATGGCCTCCCACTGCACGTGGCAAAGAGCTGAGCAGCGTCCGTCGACC
ACTTCAACGTGAGCCGTCTCACTGGTGTACGCCACACATCCTGCAGTTTCTACGCAACGCGCGACATGTTTAACGTGTGAGTAATGCGGAGCGGACCAAT
CGGGTGCGGCCACTGACGTAGCCCGTAACGGCCACTCAGCTGCCGAGGCTTCGGCCAAGCGAGCGCCGTCTCCGTCACCTCCATCCATCTGGCAAGTTCT
CCCGGAGAGTGCAAGTGAGAGATGGTGCTGCTGTGCTCGACGCCGCCGGCCCCACTGCCCGTGGACGTGGCTGCGACCCGCCCGTTGGTGCAGGAGCTGG
CGACCTCTGCCGCCGCGCGAGAGCATGTCCGAGCGTTGGCCGGCACGACGTACGGTCGCTGCGTGCTCGGACTAGGTAAGACTAAGAAGGGCTGGCTGGA
TTAGATTCACGGCTATTGAAGCACTATGGGCGTGCTTGTGTTTTGACGCTGCTTCTGTGTTGTAATTCCTGGCAGCGGGCTTCCTGACGTACGCGACCGA
GCACATGGCTGCATTTGTCAAGCGCATGCACGGTGATGTGAGCTCGGAAGATCTGGCAATCACGCATGAGGTACGACTGAAGCTGGTTGTTGCATTATTC
AGCAGGTCTCTCGAAGCTGATACCATACTGTTGCTTGCAGATGCTTCTGCTACTTGCTGAGACGGTGGTTGACGAGGACAATGCTACATTTATTGGTAAG
ATCTCTGATGCAATGACACTATGCTAGTTACTTTGTTCCCTGTTCGTGGTACTGATTTGTCCGTAAATTTACAGCGCGTATTGGAGCACACCCTCTCTTG
ATGCGTCTTATGGAGAACGAGAACGAGGATATTCAAGAGGTCAGCATTTCTTGCGTTGGATTGCGATGTTTGGAGTTGCGAGACACCTCACTAATGTCGA
TGCGCGGATGAAAAACGCAACAGGCGGCTGCCGAGGTTGTCACGAGTTGCACAAGTAGTCCGTCGGCCATCACATTCCCGCACCGCGTGCGACAAGTGGG
TGAAGTGGAGCGCTTGTGGCCGCGTGCGGTGCCGCTCCCTTTTGATCCCCGAGATAACGCTCCGAAGAATGAAGACGGCTCTCAAGGCACACTGGAGGTG
CTTATTCGTCAGGTGCCTACGCGTATGACAGGACAGAGGAAGACTGGATACCTCCTATGGGGAGCAGCTTTTGTCCTCGCGCGTTGGATTCACAAGCACC
GTGAGCTGTTTGAAGACAAGAGCGTGATTGAGGTCGGCAGCGGTCTCGGACTCGGAGGTATTGTTGCTGCCCGCTATGCAAGGCAGACGACGCTGACGGA
CTACCAGAGCGATACGTGTACTGCTCTCGAGTACAATGTCCAGCTGAACAAACCGTTTACGCACGAATTTGACCCGACCAAGCCGGAAGTGAAGGTAAGC
CTCTTGGATTGGGACACCTCTGAAAGCATCGAAGCGGTTCCCAAGGCAGAAGTCGTGATCGCCAGCGACATCATCTGTGAGCCGAGTACGGCTGAAGGTT
TCTTGCGTGTGGTTCGACACCACGTGCTTGGTAACCCCAACGGCGTTGCCTACCTCATGAACGCTAACAGCCACAGCCGCTTCGGTGTCATCCACCTCCA
CGCTCTTCTAGCCGCCAGTACTGATCTTTCCTACAGCATCACGCCTGTGGGTGAGCTGCCTGATGGCGCAGAGCTTCTTGAGACGGTCAGCGACGCACAG
GAGCTCTCTTACGAGTTCTACGAAATCCGTGCGGCATCTCAGTAAACCGAGTACTAGTAGTAGAGATCACAGGATACAAAGCCAAAGCGTATCCCGATAG
GATTTCAATAGAGTGTTTAGAGAAGTCCTATTGATCTTTCGGTCGCATTGCGTTAGTGCTCCCAGCACTTCGGCGGAGAGGCTATCTAAACGAGGATATT
GTACGCCACAGGTCCAGTGCATCGCGGATCGTCTGGAAACCCGTCCCCGTTCGGATTCGAATTGCCAGGAATGCCAGTGGCAACACAGGAGCAGCGTCCT
GATCCACAACGGTTTGACTTCGCGCGTTGAAGCATTTCCTCCCGCGTCTTGAATTGTTGGCCAGGTTGGGGGCAGCTATAGGGCATCCTCATCTGCAGTC
GCTTCCACATGGGGCTGTCTTGGCACATGAGCTGCTGTGCTGAAGTTAGAGTGCAGGAATTGCAAGTCCGACAAATACGATCTACCCCTGCTGCACAAGG
CGAGACTTCGTACTCGTCCAACGTGCATTGAGTACACGGTGAGCATACTCGATCCGTTGTTGGGGAGCAGGCAACGGAAACGAATTGGCCCGCTCGACAC
TCCGTACACGCTGGTGTTTGCATACACAGAGGCACACGATTAGCCTGTGCATAGGAGTTTTGCGTGTCTAGCAGTACACTTACGGTAACAAAGCGTATCT
TGCGTAGCTCTGCAAGCTTCAAGTGCAAACGAATTTCCAGGACAAACGCTGCAGGTTGCACAGACTCGGTTTTTAAGATCTGAGCACGAACTGACGAGAT
AGGATCCGGTTGGACACGCTGAGCAGTCTGCGGGTGAAACTTGAAGCAGTTTTCCGGGGCCAACGATCGTCACAGCGTTACCGGCAAAGTCTGCGACGAA
GGTGTTGTCAATTCCCAGAAATGTGTTTGCCTTTGTGATACCGACCTGGCCAGTACCAAACGCGTTTAGAGCGGTGACATCGGTACGGCCCAGTTGTAGA
GTAAGAAACGTGTAGTCTGCCGGCAGGCGATTTGAATCTCGTAGCGTGGCGCCACTCAATGGATCTGGCTGAGGCGAAAACAGACGCGTAGTCGCAGATG
AAAGTGGGTAGACATCGATACCCGCCGCGGTCTCCGAGAATGTAAGACCCTCGATTTTAAGGGTGGCAAAGTCTACGGCTTCTGAAAAGTGCAGCTTCAG
CAGGCGGCGTGGCAAATCCAGACTATAACTCAATAGTTTGGGTGGAACAGTATCTGCCTTGAACTTGGTGACACTGATGGCTGCGCTTGAAGGTGTGGCT
ACCGTCATCATCGGAGAGCAAGCAAGGATCCCGCTGCTTTGGCAGTTGTTAAGCACGTACTGGAAAAGACCAGCATCGACGCTTAAGAACGCGGTATTTG
CGCTCTGCGCCAGACCGACTACACGTTTGAGCGAATTGAGATCCCCCACACCAATGTTAACCACAATTGTTGTTCCGTCCAAGCTGCTCGTGCTCGTCTG
CTGCGGAGAAAACCGAAAGGTAGCGCCATACTTCAGCTCACGCTCGGACTGCAGTAGCAGTTTGCTCACATCCAGCGTTGATGCTTGGACTGGAACGTTC
ATCCGGAGAGTAAGCGCACCCAATGCCATATCGAGATCAAATGATTCAATATGCGGACCTTGGGCAATTCCTACCAGCACCACTTCGAGAACGTTACAAT
CTCCGACTGTTGTTCCAGTCACGTCGGAAAGTTGCAGCCAGAAAGAGCGCGGTCGAGGGTCATAGCTAGTGGGCGTTAAGATTTGCAGAACAACGTACTT
TACCTCAGAGTCGCCATTTGCCCAAGTGACAGCAGTGTTTATGAGTGGCTCGAAATCCACTCCAGGCGTTGCTGTCCCCGCTACAGTATTCACGGTGACG
CGTACCGGGACGGGAAAAGCTGCAAAGTTGCGTTGAATGGCGACCGACAGCACCCCTTGCTCGGTCATCATTACACTAGGACACAATTGGAGCCGCGAGC
TTGTGTTGCGCGAGGCCAGCTCGATGAAGCTTAGATCTGGAACTTTCAACACAGACTCCAGGGGCTCGCGAGCAGCGAAGTTGATGTCACCGAGGAACAC
ATTGGTCACACTGGCAATATCCACGTACGTAGTACTCGCATGAACGCCGTTAATTGGGGCCCCTACGCTATTTCGTAGCACAATCGCGACACGTCGAACT
GGTAGCCTTGGATCTGGTCGAGACAAGGCTTTCACGATAATTTGTCGGTCGCTGACGTCACCTTCTTTCCATGACAGCGTTTGCTCTAGTGGTTCGTAGT
CCAACCCTGCTAAGGCCGTACCATCTTGAGTAGCAACTGTAACGGAGCAATCTCCGTCACTCCCATTTCGTCGCTGGACCGTCAGGCGGGCGGTGCCTCC
TGCGAACATTGAGTACTTGGTACTCGCGCAGTCTGGAAAACAGTCAGCATCGAACTGTAGAGTGCCCGACTTTGCATCGTTCGGACCAGCGATGGTCACG
ACCATTTCTCCAATGTCTCCTATTGCCCCTGTGCCGATCGTGTCACCGTCCGTGGCCGCCACTTTTACTAAGCGTAAAAGGAAGTTCTCCGATAATTCGT
ACAACCCATCGTCTGGAACTTGCAACACGATATTCTGTGTTCGATTGGTAACACTGGCTGGGTAATTGTCACGCTTCCACTGCAAAAGCTGCGTCAGTGG
AGATACCAATTCAAAGTCTCCTGGCGAGCACGCACTCTTGCACACAATCTGAAATTTGACACTAGCAGTCGACGTCGTGCCAGCGACCCAGAGAACAGGA
ATGGTTAATGTGTTGCCTTCTGATATAGTCACTGCGGCGTCCTTAAAACTAAAGCTACCGGGTACGACTGGAAAATGCAGTGATAGTCAGTTGTTTGCAG
CGTACCAGCATCGCAAGAGATTCATACAACTCACGGTTGGAAGGAGGTACCAGCACCACTTGTGTTCGGTTGCGATCTGGGTTGATGTCCGCTCCAATCG
AGTCATGCAGCTTCAACATGAAGATTTTTGGGCTCTCTTGAGGTTTGCCGTCGTTGTAGATAGGTAAGTAGATCGCCTTCTCAAAGTCTTCGCCATCCTG
CCACACGAGACTGACGTTGAACAACGGTTTGTAGTCTCGCCCAGCAACAGCGGTCCCCACACCGGGAATGGTTGATACATATACTGCAGCACGACCGTCG
GATCCAAGACTGCGCTGCACCGTAATGTAGGCGACTCCAAAATCTTCCGTAGTAGAGTAGACGGCTTGGGTGAACTGGAACCTTCCATTGGCAGCGGCAT
CAGCACCTCGTAAGGCTTCAAACAGGACAAGAAATCCCACAAGTAGCAGTAACCAGTGGTGCTGGCATTGCCTAAAGATCGCCATGATCGACAGCCGACG
CTTTGAAATAGCTGTTTGGTTTAGCTGAACGAAACCACACCGACGCTTCATCGGTCATATCGAAAACGTAGACTTCTGAGAGCATGGCTGAAGTAGCCCG
CGGCTTCTCTTAGTGTTTTTGATCCGGATACTGCAAAATGGGCAAGGTGTCGGTAGCTCAAGTGCCACAGGATGTCCCTGGGAGTGCCTCTCGCGAGATA
TTCCAGGGGCTCTTCAAGGACTTGGGGAAGCAAGCGATGGCGATGGAAGCTATACTTCGAGCGGTTTGTGGTCGTGTGGACAAAATGGAGAACTGGCTGA
CAGAAGTGAGCTTCGGCATGACGGAGCTGGATCTGAAGTTGAGAAATATCGCGCACAATATCGACGGAACGGCAGCGGTGGATGACGAAGCTCAAGGACC
ACATCGGTGGGCCATTCCTCCCCCTGACGACGCGAAGCCCTTGGCGCCAACAGTAAGCAAGAAGCTTGGAGCCGACAAGAAAGCGGTCCGTGTGACGGGA
ATGGCCGCTGCTATCTTGGACCGACTCGCTGCACCTTCGACAAGCACTCCTACTGCGGTTGAAGCAGAGAAAGTGGAGAAATCTGGAGCGAAGAAGAAGA
ACAAGGAGAAGAAGCATGGTGCTAAAAAGGCGAAGATGAGTTGCCTTCCAGAAGTCCCAGTAACTTCGTCGCTTGCTGCAGTTGAGGTTGCTCCTCCTCC
CGCCATCCAGCTGCCTACTCCTATGACGTCTGCTGAAGCTCTACATATTCCAGCACCCGAAGACCATCCAGTGATAGAATCGATGCCGGTTCCTGAGATT
CACGAGGAAACACCCGGTGCATCGACACTATCTCAACAAGCACCAGCGCTCCAGCCTCCGGAAAGGGAGGTTGCGGTGGAGGATGTAGTTGTTTCTACTG
CGCCGCCGAATGTTGATAACATACCACCAGCAACGCAGCAAGAAAACCCCTTCACAGTCGAAGTTCCTGTTGAGCATGGCGTCACTCCAGCCGAATCGTT
AGCGGAGCCACAACCTGTGGAGGAGCACACTGTACCAGTTCCGAATCCGGCAGTCCCTCAATCTGAAGAATCCTCAAGTGAAAGCAGTCCAGCGATGTCA
CCAAGGGAAACAAAAACGATTGAGGCATCGGAACAAAGCCCAGCAGCACCGATAGATCATGTCCAATTTCAAGAAACTGAAACACCCCCGACAACCAGTG
AGCAAGATTGTGGTAACTCCACGCCAAGTACTACTACTTTGGAGCAACATGAGACCGTTGTTCCCGCCCCCGAGCCATCGCCACCGGTACCAGCAACATC
TCCGCAAGATACTGTCACCGATATCGCATCGGTGACTTCGGCACCGAAGGTAGCAGCCCCAGTAGTGAAGCCGGTTGCCAAAACTCCAGAGCCAACCTCA
TCAGTCTCAAGTATTCTTCCTACTGTTCAAGTTGAACGAGCTACTGAGCCGTTCGTATTGAAGGGATCGGCGCATACAACCACGGCCCCTGTTACTCCTC
CTCCTAGCAATACCCCTGAACCAGTCACCACCGTTTCGGAGCCTCAAGCAGCTACTATTGCGGATAATGTGGTCGTGATGAAGGTGGACGTGGAATCCAA
CACAGCTTTAACAACACATCATTCGGCGAATAGTGACAAGCGGCCAACATTGCCAGAATCTGTTGCGGTAGCAACAAAAGCAGTTAAGCTTAAGGCCACC
GGAATCCCGACGTCGCCACCATTATCCCCCCACGCTTCAGAAACAACGGGGCCAGCAGTTGATCCACTTTTACCGCACAGAACTGCGGCACATCGACGAT
CTTCAAAAATGGCGGCAAGACCAAGTCTTACAAAGAAGCTTGAGCACGGCGCTGATAGTGATCCGTCACGGCGATTATCAGGAAATAAGCGTGGATCGGA
CTTGACACGAAACTCAATTGCTCCGCCAGCTCAAGAGCACCCCTCTCATCATCCAGTACACCAACCTTCACAGGTCAATGCACAACCATCGCCGAGCTCG
CAGTCAATATCTCAGGGTCCAGTCACGCCCACGATTTCCACGGCGGCAATGTCTGAAGAAATTCACGAAGAAAGTGGTGAAAGCGGCAGCGATTCCTCAT
CAGACGGATCTGGATCGTCTAGTGAAGATGAAGATGCTGAAGCGGGAGCTGCCGTCGAGGAGATTTCCAACACTATGACCGCTCTAAAGAAGCTGAAGCG
AGCTCAGATGCTGTCACCTGAAGAAGAAAAGGAGCTGAAAGAGCGAGCCCACAAGAAATGGTTCCAGCTCAAGGGTCATATCAAGGAAAAACAAAAGAAA
GATGTGACGAACATCCTACTTAAGCGCAAGAAGAACGTATTCACAGTATCATCGAGGATTGAGCTGCTGGAAGAGAAATCGCGTGAGATTTTCGCTGCAC
TCAAGCAGATTACGAACGAAATGCGCGACAAGAGCGACCGTGCTACGCATGAAACGTTGCGTCGCCGCGTTGCTGATATTGAGCACAGTCTGCAGAGTAT
CGATTCCAGAATTGCGTCTTTGTCAGCGCCCGCATTTGAGAAAGTTGGTGACCTAGAAGATGAGGTGAACTCGTTACGCAGTACCGTGGAGCTTCAGCTT
ACGACCGCCCAGGCTGAAGCTACAGCCAGGCATTCGCTGCTTGAGGAGGCTCTAGCTACTCAACGAACACTGGTTGAATCGTTGACCCAAGATTTCCCGG
CCCAACTGGCAACCCAAGCTGAGCTCTTCAACGAAAAGCTCAAGCAGCTACCCGACTACACTGCAGCGATAGAGAACCTCCGACGGGGTCTAAAGCGCAA
AGCGGATTTGAAGCTCCTGAAAGAGTACGATACGCGCAAGCTTTTCGCTATTCACCCGACAGATTTTGATAAACTGACGTTTGGATTTGCTCTGATATGA
ACAGGTTAGAAGCTCGGTTGCTCGGTCTGGATGCGGAGAATGAGGACTGTCTGGTGCGCTGCTTATCCTGCCGCAAAGAGGTCACTAACCCGTACAACGA
CAAAGATACTGAAGGCGATGATCAGGATATTGTGAGCTCTGGAGGTGGCGTCTCACAGCTGCGGAAGATTAACACTGGCCCAACTTCGTCTCGGATCTAC
CGCTCAAACATACCATTCAGTGCCCAGCCGATGGTCCAGGAGGCCATTCTAGAGGAATCCCCTGATGAAACCTTTTTGCCACCTCAAGCGTTGTTGCAGC
CACTGCCACAGTCGATAGCGATGCAAGAGCCTCAACTTCGTCAACAGCTCCAGTCAGCGGGGGATTCTCATGCAAGTGAGAAACCTCCAGTTGTTCGTGT
CCCTAGCGTGAGGTGGTCGACCCCACCAGAATCTTTGAAACGAGAGGCCAAAACCCCACAACCTTCACCTCTCAGGTAAGTTTTGGGCCCATTCTTCTCC
TATCGTGGTGGGCTTCAATTGACGTTTTTACGCAATGACTGTTCCCTGTAGTTTGATGAACATTACCGCGACGCGTGCCATTCTATCACCCGATCGGCCG
ATCAGCGCCCCCGTGATCCCAATTAAAAAGAAGGCAAGTACCGCAGTCAGGTCGAAGTCGGTATTAAAGTCACTATCCTCTTCTTTAGATCCACCTCAGA
AGGACTAGTGGTAAACCCAGCGCTGTCCAGATACACCACAATATATAGCTTTTCACTTACTTCCAGGGTTGCCTTTAATATGAAGTAATCGCCGACACAG
TCCAGACCTCTTCCTGTCATTCTCCATATTCGTATCGGGAGTGATAACGTCGACCAACCGTCCTCGACTTGCGAGTTGCCGCGATGGTGGACGCCCATGA
CGTTGGCGTTTCTCAGCTGCAACATCGAGTTTTGGCCCAAGCTTTGGCTGGAGTTGCTGATTTGATAGCTCCGCAATAACACGAGTCTCTTTGATCAACT
GAGCACTCCTCATCGAAGCAGCAACCACAGCAGGATCAACGCACAGTTGGAGATCGTGGTGCCCAGTATCTTGACTGCAGTCGTATTGTCCGGCGCGGCG
TAGCGAGGGAAACAAACCTTCTGCATTTTGTAAAGGTGTCGTGAATGATCCAAGAGCTTTTATGGGCGACTTTGTTGGCGACGTGGGCGCCGACTCTCTT
GGAATGGCTGTAGATCCTGAAAGTGGGGAATATCTTCTGTCGTTGTTTGGCCTTGTCGGTAGTTGACGATCTCGTAAATAGTGAAGCAGGTCCATCTGCA
TTGGTGGCCCAGGCAACTTTGTAGATGGGGAGTTGTTGGCTGTTTGCATGGTTCTCTTCAACGAAGATAGGTGAGGCGAGAGAAGAGGAAAATCTTTCTC
TTTTGGAGTAGTTCTTTCTGCCAAGCGTATCGAATGCGTTGCACTTTCAGCCCTATGCTTCTGTTGAGCCGCAATTGCTGCTCGTACAGTTTGAAGCCCT
CCACGTCCGAGCAATGCCACAATGAACAATTCTTGGTTTCGCCGTGATAATGCCCCTGTCGCAAATGTTTCAGGATTGCATCGGTACAATTCAACGCCCA
AAGCATTTACGATGGGGGAGTCTGCAACAGCGTACTCTGCGTCAGGTAACTCCGTCGAGGTATTACTGTTCGTCAACAACCCCCGGTTGGTAGCATCACC
CTTTTCATCAGCATACAAAATCGTACATGGGCCCAAAGAGGCCACTGGAGTATCAATCGCCAGTTTCGGACTACCAGCAGTACTTTGTAGAGGGACACGT
AGTGGGGGTTTCCGCCGGGGCTTTCGCTGAAGTGCTACGTACTTGTGCATAATGCAAAGTCCGCTTTCAATCACGAGCAAAGTTTCCCGAGGAGTATAAT
TCCCAAAAACAACTACCAAATTCGAAAATAAAAGTGTTAGGAGTGTAGTATTCTACGATAAATAAACGATGGCGTCATTGAGCTTACCTTCGTTGCGCTT
GAAACTGAGCTCTTTCACGGAATAGTACATCGAGCATAGTTGTTCTGGTTCGAGAGGAGATGCAGCATCAAATGCTCGCTTAAGCGTCGCGAATTTGGAT
TTGAGACGCTCTCTCTGAGGCCACAAACTAAGGAATACCGCTTTGGGGACCCGAAGAAGTTTAGTGGCCGTACTTGACACAACCGCTTCAATCAGACGTC
TATTAGAGTCAAGCATGAGCTCAACCTCTCCAAACGTATCTCCTGGCTTCAGCACTCGTATTGATACTTTGGTTCCCCGAGCATCTGAGCTGGTCCCCGC
TGCTAAAGACCCAGAAGCCGGTAGCGGTGAGTCTAGCACTTGTTGTATGGTGACGGAGCCCTCGATAACCAGGAACATCTGATCAACCAACTCCTCGTCT
CTCTCGAACACGACCGAATCGAGCGACGCAACTTCCACCATACAGTGCGTGCATATCTCCAGGTATTGTTGTTTTGGTATATCCTTAAATATTGACAAAT
GATGCACCATCGTATACGTCAGTCCTGCACGGTAATGAAACTCTTGCTCGAGTTGTGAGCTCCATCGAGGTCGCTTTTGCGTAATTCGAAATATAGCAGC
TTTCCAATTGTTCGCCGTTGATCTTCGATAACGAGCAATATCATTTAGTTAGACAAATACATATCCAGCAACAGTTTGAGTCTAACTGGTATGGTTTACC
GTTTATGCAGTTGAGAATGATGCGTTGCTAGAGATAGGCGGTCTTGGTTGTGATCATGAGAAAAACATTTTGGAGATGATACCTCGATAAAACCATCACG
CAAAAGATACACCAACTTGACAGTTTTGTTGCCGTTGGCTCCTACAACAGCTACCGCTGTCGTCAAGCGTCGGCTATCGCCAATAAGGCATTCTTCCCCA
AACGCGTCACCCTCGCACAAGTCAATAGACCAATAGTCATCTGCTGGTGATGTCGGGGGAGACCTGGTTGCTCCTGGGCTGCGCTCCCGCCCGTTGAATC
TGCATAAGCAAGGTGCGCACTACGCATCACTACCTGAACATCGATCCCAACTCGAGCGAAAAATGGGTGAAACTTACAGGCGCACTCGACCAGATAAAAT
GAAGTATGCAGCAACCCCCTCTTCGCCACACCTGTACACTATAATTCGCAGAAAGACAGTTTTTTTTTCTCTGACGTATCCCTGCATTTTTCGTAATAAA
ACAATCTTACCTGTGTTTCCAGCGCTCATCTCAATATACTGCAGAGCATCAGCTACTTTATGGAGCTCATGCGTAGTTAACCGCTTCGCAAGACCCATTC
TCTCGAGAATTTGGTAGCGAGCGTTTTTTAGTGAGGAATTTGTTTCATCTCCGCGTACTTCATGTTGGTCCGTATCCCGGCCTTCCACAGCAGCTAGTAA
ATCTTCTTTAACTTCGGGGTCCAATGTGTACATATCGTCAAGGGTACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
TTCAAGTCAACGACATGTTTGTAATCACGAATATAAAAGTCATCATCCACTGGTTTGGTAAATGCAAAGATCCCTGGTTCTAGAGCCCTTGCAGAATCTT
GAGAGGTGATAGTTTCGGTAGCTGGAAATTCTTTTACGCCACCTTTAGAGCGAGTAGATAATCTCTGGTCGCTTTTCATCTCCGCTACCGGGCCACGAAA
TATCCTAACATGACCTTCAAGGACAATGAAGACACATCCTTTCGTAACTTCTCCCGCTTCGAATATAAAATGGTTAGCTGGGACGTTGACTGTCTGCATT
CGGCCAATCATGAATTTCAACTTGGTGCTCGGAAGTCCAGAAATCGCAGGACAATGATGTAAAAGTCGCTCGAACTCGCTCTTCGCGTAAACCTTCCGCG
GTGCACTAAGCTGCAAGCGTGAAGTGGTTCTCACGGCTCGAATAGTTTGCCGCAATGCACGCACAGGATGACAAACCAAATATTCGTCAATTCGAGCAAG
GCAAATTCTTGCCAGTTCGCCTGGAATACTAAGAATTTTGGCCGGGTTTCCAGGAGAATCCACGCCAGCGTATGCCACATATCCGAAAGGGCTTGTGGAA
CCGAGGAGTACCGGCAATAAACCAAACGCACTGCCGCGACAAAGTACTCCAATGGGCTCCACAAACGCAGCACCTCCCTTTCCGAGACACGAAGGACTTT
GGCTGGTCGGTGCCATAGGAGCATCTTCTTGATTGATTGGCATGCAATCTCCTTCATCACTGCTGTATTGTGCATGTTCGTTTCTCGTTCGATCAGCTCG
TGCATGAGTTCTGAATACTCGAAGATATCCATCCAACAAAATTTTGAGACTCGTGCACTCTGCCCCTTGTTCTTGGACGCACGTGAGCTCTTTTCCAACC
ACGGAATGTGTGTCCAGCGTAGCGCTCAAACAAAATTGCCGCACAACAGCCAGCGGGAGCTGATTGAAGAACGCCTTCGCTGATGAATATCTTGAGAAAA
ATATTTCTAGATAGCCCAGCTGCTCGCAGGTGCGGTCGCGCGGAGGCCTTGATGTCAAAATGCTGTAAGCTGTTGAGACTGCAAAATCCGTGTCCAGATA
ACTCAATCGTGAGGCGAAATAGTCATCAACGGCAACACTTATTGCGTAGGACGCGTCATCGCAGCCTTGCGGTACCGAAAGCAACACACCTTCGGCATCA
GAACGGTTGAAATTCAAGGAAGAGCTCAAAAGAAAGCTTTCCCCGTATGAATCTCCTTCAAATAGTTTGCCAATATGAATAGCCGGAATCGTTCCTGGTG
CGTGCGTCTCACAGCAGCAAACGGTGTCGGTGTCGTGATCTCTGAGCAGCTTAGCATTTGACTTTAGGTGGTTGAACGCCGCCACGTTGCGGCTTCGATC
CGTCGCTAAAGCATTCAATTGAATTTCTTCCGTGCTTTCCGGAACGTGAACACAGCACTCACCACTCAGCAAAAAGTATACTTTGGTTACGCCATCGTAA
GCCGGGTGCAACCTTTCACCAGGTTCGAACACGTGAAGTTGTAGCTTTTGAGCAAGTTGAAGTAGAATATCATGCGGCAGCTTTCGGAAGCATTCGTAGC
GATGGAGAAACCGCTTCACTACTCGCATGACATGTTGGTCAGCTAGCATCGCTGTATCCAATCGAAAGGGCGCTGTAGAATGCAAATCTGGCTTGTTGAA
AAGGAGATGAACATCGCTCAGTATTCTTGCTTCCGCCTCCACGTTAAACCGTGCGATACGAAGATAATCCGCTTTCGTGACGAAGGCTATCACTGCGTAC
CAAAATCAACAAGTAAAAATAAGACCCCATATTTTGCAGCAGCCAAATGTACAGCGACCAAGATTCTTACACGAGGTGGTTTGCGCCAGCACTGTCGTCT
TCCGAAGAACTGCACCAGTAGTAGCATCCTTTTTGAGTGTCGTGCCAAACCACAAATATGTTTTAGCAAAAAGGTAGGCAGTATCCCAATACCGTTCCCA
GCGCAACTACCCACCTCGCCACAGTTCGATCCTTGGTTGCACGTGCCGATACACTTGCCCAACCTGTCGACACCTTCGCCACTCCTACTACCTTGAGGGT
GATCTCCAGCATCTTCCTGCTTGGAAAACACCAACAAAGACCCCAAAACGACAAGAAATCGTCCACTTGTATCGTCAATGGCATCTCCTTGTCGAAACAC
CGCCTCCCCATCATGCACGACTCGGAAGTGCAAAACTCTGGCCAGTGCTGCATGCAAACACGGCATTTCCGGCCGTTAACACCTAAACCACCCATTCCAC
CGCAACACCACAAAGTGTCCCACCGTCAGTGGAAGCCGAGGACAAGCCGGCGTTAAACCTGCTCCGCCGAAGGAGCTCTGCCTGGTGTGCCACACAACGT
CAGCCCAAGCAATTCAGCCACCCAACCACCACTTGAAACTCTCCGCACCAATAGCTTGACGTCCACGTCTGAGCGGCAGTGGAACCTGTTGACAGCCATT
TCCACTCAGTAACTTTCCCTCTAAAATAATTATTACCTATTATTTATGCAACAAATTAGTAAAATAACCTACGGTTTAGATACGATCCTCCGCAGCAGAG
CTCTCTTCTTGTCCGCGCAACAGCCGTCGACTTCGTACGGGAACGCGTCGCGGAACGAGGTGCATGTGTGCGTGGGGGCGGCCGCCCGCCTCGAGCGCAG
CAGCCGCAGCACGAGCGCCGCCGCTCGCAGCGTGCGCCACCGCCGGCTCGGGCTCATAAGACGACTTCAACCTGGTTTTTGGGCCAATCGCCGCGCAGGA
TTTGCAGCACTCGTTTCGTTGGCTGAGCCGAACACGCAGAGCGGTTTCGCGGGGCATACAAAGCGCAAGGTATTTTCGTGGCAGCCACTCGCCCGGCCTC
CGCACCCCTTTGTCAGTTGTCAGTTCACTCCGTCCGAGCGTCAAGCAGCGCTCGCTTAGCTCCAGCCTCAGCCTCAGCCCCCCCCCTCCCTCTTCAACCA
TGTGCGGCATTATCGCGTTGATGCTGGCCAACAAGTACGAGCACTGCAACCAGGGGCTCTACGATGGACTCACGGTGCTGCAGCACCGCGGACAAGGTAA
CTAACTAGGCCACGTCAGGGGGGTTACTGCTGGGCTAACGGATACTTGCCGCTTGTTGCGAATTGCAGACGCTGCCGGCATCATGACCTGCGAGAAGAAG
CGCCTGTTCCTGCGCAAGGACAACGGCCTCGTGCGCGACGTGTTCAAGCAGAACCACATGCTCAACCTGCGCGGCAACATGGGCATCGGCCACTGCCGCT
ACCCGACGGCGGGCTCGAGCTCGAGCTCGGAGGCGCAACCCTTCTACACCAACTCGCCCTACGGCGTGGCGCTCGCGCACAACGGCAACCTCACCAACTC
GCACGAGCTCGTGGACCAGCTGGCCAACACCAACTTCCGCCACGT