Description :
From Genome Similarity Track
Location :
Scaffold_192:30976- 36716
Transcript NameFunction/comments
Phyta_totarag5361hypothetical protein
Phyta_totarag5362hypothetical protein

Sequence
5740 bases(100 bases per row)
ACCAATCCAGTAGAACTCCTCGAGGTCGTCCAGATAGTCCAGTGAATGAACGAAAGTCTTCGACATCAAAGAACACCAATGGTGCCTGTGGTGGTAAAGC
GCGATATCAAATCTGCGAACACATGAGCAGTAAGTTAGGGCTTGGTTCAATATGAAGGCAACTGCTACGACTTACGCGCAAGCGGATTGTACTGCCATCA
GATCTTTGGTTGAGAAAGCGATATCTTCGTTCTTTAGTCCAAGCGACTGCTTCAACCATTGAGCATTTTTTACCATGACGCTAGATCTCTGAAATTCGTG
TAGTTGTTCTTGCGCCATTTGGTTTGTCTTCACCTCTCGCTGGTATCGAGCGCACTGGTCAAAGAACCGCAGCAAAACATCCTAAGTGGGAAAAACGGAT
TAGCCATGACGGTCTATCCAGAGTGAACAAATTTTAATACTTGTTGCAACAGCTACCTTGTCTTTGGGGTACTCGATGTATTCCACAGCCTTCGCGTTCG
CAAAGAACGAGGTTGCAAACCTATTCAACAAAAATATGTCAGCTAAAAGCaaacaaacacacaaaacTGCGTCATCCGATTGGAATTCGTGAAAATCGTA
CGCAATAGCAGAATCTCGAGTCCTCGTCACATGCGTGTGTACAACACGGTATTTCTCCTTCGAGTACTCCTCCGGTCTGTCATGTCCACTTCTAGCAAGA
CTCCGAGCACCAAGCTCACATAGCTCACGttttccagcttctgcaAGGTCCGCCTTCACACTCATGTTGTACGGCAGCGTGTAGTTTTGCATCCACTTGG
GCAACAAATTCTCGAAAGGTTGCAATCTCTCGAGCAGATCCTCAATCTCCTGAATATTCCCACCCGTAGGGtacctacatgtagcagcaTCGAAACACCT
TAAAGCTTAGTTTATCTTTAGAGTTCGACGTAAAAGTTACTTAATCCCTACCGACTTCCGTGACGTGCCACGATTTGAGTCTGTATCAACTGCAATTCCT
GTCGAAGTGGCTCCCGGTTCGTTGTATCAGCGAATGCTGGAAGAGTCAACATAGCTCTCATCATTGCAGTGTCAGTTATGTCGCTATTTCCATTGCGTTG
GTCCCAATACTTGGTTTTGGTAGCGAACATGAGCTCGAACTTGTAAGTTTGGGACACCTCCGGGAATCGGAAACTACTCGAAGTGCCCGATAAGAAGGAG
CTTGACATTTGCAGAGCCACTACAACGAAGACCAGTGAAGCCAATGCAAGTGCGTGGAAAAGGCGATTCGAGGCGTGTCGAGTAGATGGCAGCGATGAAG
CGACGGAGCTCCTCATAGTCGATCAGACGCTTTTTTATTATCAGGTCCAAGGAAGGATTTTATGATATCgtattagccaatcagataTGTTGTATAAGAA
ATGGCAACACTTGAAGTGAAGTGTGGACATCTGTGGACACCCCGGGCGTTAGAAATGTAATGCAAGTTGTTGTATTGAAACTACGGAAGTGACTAACGAT
AGTTTTGACTCAAAAGTGCAGCAATATGTACGACAATCGGCCGATTGGGTCGACCAGGTTCTTGGACTTCATTCATCTCTCATGGTACCTTCAGCTGGAC
CTTCTCCTGCATCAAGCGGCTTTGTCTTGTGTTTATCATGCTAATCGAACCAGCCACAAAGTGTTTGACAAACGCCGCCGATCCATTATCTCCATTtagt
cgtcgtcatcgtacTCCAGAGTAAACTCGGGCTCAACTGTatcagcatcgtcgtcgtccgccaaGACCTTGGCGCTGGGGGTCGGCGCAGCGGCTCCATA
CGATTGACTACCCGAACCAGGGGATGGCAAAACGGGGGCAACGCCTGGGACCCGGCTTCGACCTTGGTCAACACTGCTCGAATAAGAAGGACCTTGGTTC
ATAAACGTCGAGCTGGCCGAGGCGTACGCCCCTGGGTAACCTTGCGGGGGAGCCAACGAGGCAGACGGGTGGTCGGGCTGTAGCCGGCGCCCACCTGGCG
AGGGCGCAGCGGCGTTAGCATAAGATACAGAAGAATCGTCTCCTCTACTGCCGCGATCACCGTGTGGTTCATTATATACAGCTTGCGGGGCTCCGTAAGA
TCTAGCTTGGGGCGAAGGAGCTGGTACGTTAGCAGAAGGCGAAACGCGTGACTGATGTGCCTGCTCCATTCCTGGTCGCGAACTCGGCGACGTTTGCCAG
CGGCCTCCAGCCTGGTCAACATGCATGGGAGGTCTTGGCGGGTGACTCACAGACTTGTCAAGTTCATCTTCTCCGTGAGCAAAGCTGAAAGAGAGAGATC
CACGTACACGGCAAAATACAGGGCCCGCAAAGGGAGTCCATCATCAGAGAACCGTCCATTAAAGAAAAGAGGCAAGACAACCTAAATGCCACCTCCCAAG
CAAGGCAGCTGTCAATGCTACTGATCAAATAGTACCTGCAGTTATCTCCAAACCGACATTTTCCCAGCGGGTAGTTGTTACACAGCACAGTCTTGCGCTT
AGTTTCAGCCACTTCTGGCCGGCTCCCTCCCGACTGAGCTTGTGGGTCGTGAATATGCCTAAAGTAAATCAAGCCACGAGAAACACCAAGTCAGTACTCG
GTCGTATCATGTCACTCAAAACAAGGTCTCAAACGACCACCGTACCAGCAACGGTCGCCAAACGTGCATCTGCCAGCCAGAAAGTTGCGGCAAATTTCCC
CAGAGGTCCCAGGGACACGATTACCAGGACTGCGCCGATCGTCCGATCCAGAAAATGGCGATCGTTGCATTCCGCCCTGATCGTAAGGGCTCACATTGTG
TCTACCTAGACTTCCAGACTGTGGTGATCGCATACCTTCACTACGTGGCCATCCCGATCCTGAACCACGAGAGGAAGGTGCATTTCTGTTCCACTCTTCG
TGTCTTGCCGGGGCCCCGCGGGGAGATTGTAACAACGGGGTCTGGCGAGATGAGCCAGGTGGTGACCCGTAACCAGATCTGCCACTATTAGGGTGATAAT
CTCCCTCTCTGTCCAGTGACGTAATTATTGGGGCAGGTCTATCATTTGAGGGTGGGTTGTCCAACTTAGGCGGTCCCCACCGGGACCCGCGAGGCTTCTT
TGGGTCGCGCCCATCCATGTCGCTAGGGTGATCGTCAGGGGCTCTACGGACACGACCACCTCCGACTGGCACACCAGGTGCGTCCCCCATGATGCCGCCA
ACGTCTCTGTGGTCGTAGCATTGATCATCCGTTCGTTGTTCGCCATAACTTCGATGGTTATAAGCCCCAGCGTCGTCTCCCTGGCCTCTATCTCTGTCGT
AAGACTCTTCATACAGAGGCCGCCCCTGTTGCTCGCCGGAGTGCTCTTgttgctccttcttctgcttgatgaTTGACAACAGTGACGCCAATTTTCCCGG
AGATGCGCGTGGCGTGACGTTTTCCTCCTGAAAAATAGAAATTAATGTCAGATCCAGAAAAGTCCATCACACACCACAGCCGCAAGTCCACAACAGCGCG
TACTTGTCCCTGGGACAGATATTCACGTCCACCAACGTCTTCGATTTGCTTGGGCGTATAAATACCGCGCTTCTGCCACTCCTCAATCACGTGTCGCACC
TTGggctgcagcaaccacaacaacaaaaatacaAAATAAACCGTCAGCTTCCCCGCATTACCTTGAACTTAATCCCCTCTTCCTCGAACCTGAAATTGCT
CCGGGACTTTCTTCACGGCTGCGATGGTGTCCGACAGCCGAATCAAGAACCGCTTGACGTAAGCATCCTTCGGGTCGTTCTTGGCATgagactgcagcaa
ttcACAAATACAATAAGCTCAGTAAGAAAAAcataaaaaataaaaagaTTTAATAGTACCTGTCTGATAATAGCATCAATTGCATAGAGTCCTgtaacaa
caacaaataaAAGAATAAGTACGGATTCCTTTTACAACGTCACTAAGAAATTATAAAACATTACCAGCCAATCGGTGCTCGACCTCGGCCTTCCACAGAA
ACACTTCGATGTCGTGCACCACATGCTTATATAACTgcatacaaacttcaagtcAACAATCTCCTCCAACGACTCCATTCCATCCTGCCTGGGCCGCTTG
TTTGCCTACCTTGGAGTAATGCGCCGCCAGCTTGGCCACCGCGCCGATGCGGCTCTGCGACACGCCCTTGGCGGTCGCCAGCCCCTCCAGCgcctgcttg
agcttctcgaacCCTTCCCACGCACCCGAGCGCGAGCTCTTGTGGCCCTCGCGGTGGTGCTCGTGGCCCCCCATCGAGTTTCTGACTGGCCAGCCGGATC
TTGCAAATAAAATGTAGTGTGGTGCACATACAAATTATGTACCTACACTAAGATAGGATGATGAGTACTATTATAACGTTAATGCCGCTGACATTCCGAA
AAGACCGTTGACGTTGAATCTCATCTAGATTCGCCACGTTAGCTTATTGCGAATCTGCTGGTGGCGATCGCGTAATCGTCAACATGATGTGCTTGTGCTA
CGTgtacaatacatgtacaggtgCTTCAGTAGACATCAGCGAATATGTACCTTCCTACAGCAGAGAGCCTTCACCATTGCCATGGTCAACTTTACGTACG
CGTGCGGAGTGGTAAGTGAtcgatcaagatcgacctCGGCACAGCTGTTCAAAGGAACATCCTCGTTGTGTGGTCAGCCGACCAGTCCACCACAGCAAGC
AAACGGACCGTGAGAAGAGAGTGTATTGGATAAATGTTGAGGATGATCCACCAGTGGGGATCATCCAGCGGCCTCATTAGATGCCGCTGTCAGAGATATC
TGAAGCTCATTTCAAGATTTGCTCCGTTGCAAGTACGTCGCTCAGAACACTCGTCGTGATAAAGTACACGCCATGTTGAACAAAATTGTGGGTGCGCTCG
CCCTCTTCACCGCGTCGCCAAGTGCTTCTGCCAGCAGTAGCTTCAGTCTGCAGTCGTTCGCGACCAAGACCAAGTATTGGGATCAGCGCGGCTCCGTCGT
CTCTTCTGTTGCGCAAGCGAATGCAAGCGAGTCAACAGTCCAGGCCTCAGATCTCGAGTTGgtgcaactgcagcaagtgagTCGTCACGGCAGCAGGTTC
CTCACCAAGGGCAACATGGGAGAGATCGCGGATCTGCTGGACAAGCTACAGACGAACTACTCGACTGTCATCCAGATTGGTTCAAGAACTACTCACTACC
GTACAACACGACGGATGCAGGCGAGCTTGCGCCTGCTGGCTTCAAGGAGCTCGCCGGGTACGGCTCGCGGTCTCGAGTCTCAGTTGGGTCGTCCATCCCA
ACAACGTACAATGCCAGCTTATTCAAGTTGGCGCACACGAGTGTGACCCGAACTGCCGACAGTGCCCGATCGTATGTGTCTTTTGCAATTTGTTCATCGC
CGCTCTTGCACTCGTTGTGACGGCTGCAACTAACATAGTGATGACGACTAAACAGGTTTGCAAGCACATTCTTCAGCAACGCAGACAAGGTGGAGTTCAT
CGATTATCCTGACGGGGATGTAAGTTGGCGATATCTCGAATGATGTATATCCTTTATCGTTCGATTGATTAACTTCTCGATTAATACTGTTCTCGTAGGA
TACGCTActtcgcttcttcgacgtgtGTGATCGTTACAACGCCGAAGTCCTGGACAACTCCAGCGCTCTCTTGGAACTCGATGCTTATCAAACTACCTCC
AACATGAAAGAGAGTATCGAGTTTCTAAAGTCCCGGCTGA