Description :
From Genome Similarity Track
Location :
Scaffold_91:30973- 35623
Sequence
4650 bases(100 bases per row)
TTGCAACGATACCTAGTTGGAAGTTTTAGTCCCAACGAAAGCAGAAGTGATTGCGATCCGGGTACCGGTGACAGTCGATCCTTCGATTCAGTCTTCAGGG
CACAATTGGAGACTAATAGGATCTCGACATCCTGCTATATCCCTTCTTCTTGCACTTTCCTGCATTCAGGAAATTTATTCGTGGCTCCTGGGTTTGCAAT
CCAAGCAGACGAACAAACCAAACCTTATCACAAAGTTGTCGTAATTAAACGCAGCCAAGCGCTGGCAAAACCAAAAAGATCATCCATTACGGATGATCCT
AGACCGTCGATCCTACGCAAGCTTTTTCCTGCGTAACTGTAGATACGGATTAACTTTTCTTAAGGTTCAATAATATTTTTATCTTGATCCTCTTGACTTG
TCTGTTCTTCGTTGAAATGACCCTCATTGTTTAGTTTTATTGCCTCTATCTGACCCGTACGGTCGCTAACCAGTACACGAGTACATCTAGAATCCCTTCC
ACCCTTTCAAGCAACCTCCTTGCACCTATAAGTCCCTTACACGATTGATATGCAACGTCCTTGCACGTATAAGTTTCTTCCACCCTCTCACTGCGACCTG
CTTGGACAGATACAACCACCCTCGGGCATTTCAATTTTCATTAATTTTCTCATCTATTCATAAAAATTACATCATGTCGAAATGGTTCTTTACTACACGA
TCTCGACTCAATGCCAGCAAACAAAATCACAATTCAGATAGGTTTGCCGCCCAGGATGGATCGCTGTCCCTTCCTTTGTACCAGGTTTTGCCTATATATC
AAATATCGGCTCACTCGTATTAACCGATCATTGATAATTATTTCAGTTCTTCCAAAACAATTTCGCACTCCCAACTATCCCCTAGTAGCGAGGATTGGTC
AAAATAGATTTGATCTGCCTCATCCACATTATACCAACTTGTACGACACTTTGGGACAACCTTGGTTTAATTAAGATTTATAATATTCACCTATGGAAAT
AGTCGGTAGTGCGTCGTCACACTTATTGGCTACGCAAAACGGTCCATGTCACCTATGAGCGATATTTCGATCGTATCCCTCCTAGCCGCGATCCAAATAC
AGCCAAACCTTTGTTTTGGAGCCTATATACAGAAAGTCTTGATCCTCTTTATGGCTATCCTCTCTATCCTGGATAGCTAGCTTAAGTCGTCCTTTTCACC
ACCCTTACACGCTGATACTAGCTCTGTATTCCGTAATGCCATCCCCGTAAGTTTCGATTACGAGTTTCGGTGCTTCTTAATAGTAGGTTTTCTTCTAAAG
TCGATAGTGGGCCTTAATCGTGAGTCAAGTAAAACAGCTTATCTACACAGACTCGATCCTGCGTATTGCTAATTGCATACGTCAATCTTCTGCTATAAAT
TAAAAGATATGATTAAAATTTAAATTCTAAATTGACCTATTGTTAAATCGTATTCGTCCCAGTCCTTTTGGTTTTCATCCATACATACATCTTGATCTAT
CGAGTCAACGACAGCAGCATACATTCCATTACAATATTGGCTTGCGGCCTATACACCATGGTGTCCCGAGTCTTTGTACCGCAATCGGATTAAATTCCAG
TAAACCCGGACATAAACTCTGGCTCTACAATGTGGCGTATTGCCTTACTTGACCTAAACCGCACGAATACACATTTCTCATAGCTGTCTGCAATAGTTGG
TGTAGTTTCGACGAACTTGCTTTCGCGATCACGTAACCAGAAAATAATAACCTACAATAAAGTTTTTTATTCTTTATAGAATCATAACAGCGAAGTAATG
TGATCCATAGCCAAAACTAAAAAAGTACATCGCTTGTGAATTACTAGACCACCGGCCTTGACTGTATGGTCGTCTTTTTCCTGTTTCAAAATTAACTCAT
TCTCCCACCACTCGCCAATGAAAATTTCCTCAGACCCGCTGATAAGTTCAGCCTTTCCCTTGGTGGCCACCGTCCAGACTTGCATGGTAGTAGTGCTGTA
TCGGTAGCATCAAGACAAACATCAATGGAACTACCTCAGTACGATCTTTCTATCGAGTGGATGACCTCGGAGGGTAAGTTAGCAATCCACTTTGATCTAC
TTCATAATCAGGTGGTATATGGGCGCAGGCCTTTGCCTTTGCATCCCAAAGCCTAGCCTCATCTTAATTCTTATATATCTTCAGGTTAGAGATTGAGATC
GATTTATCTTTCGTTGATTGATTCGATCGATATGTACGTGCAGCACGACCCCTTCTAATCTATCGGTCTGAAAACGTCTTCTCCTGGTGGACCGAATGGC
AGCAGCAACGTTAATCGATCTACTCGTTTTGGCCGTAGTAAATTACTTAAACGATAAAGTGTGATCAGGCCGTGAAGAATTAAATCAGAGACCACAATCA
TTCCCTTTTCTAGCTGTAAGGCTTCACATTTAAGCCGATCCGCACTCTTATTTCAGTCCCGCTACATGTATTGGAAATCACTGTGCGGTCACGATCGGAG
TCGCTTCATAGCTTTTCGCTGTATTAATTGCAGCCCATTTCTTTGCAGTCTATCTCCCCTTTCATTTGATATTCCACTACATTTAATCCTCCGCAAATAA
TCACCCGTCGCCTGGTATTGTCATCGAGCAAATCGACGGTGAGGAGCAACCTCGGTACTCTGCTGTATTGTGAGATAAGGGGTAAACTCAGAAAAATAAT
CTACAGTCCTCCATGGCAATTTTCATATGATCGCGCTGTATTCCCCACTAATTCTTTTCATTCTAGCTGATCTATCGAACCGTCTACTAGGAGGCTTTCT
TCTGCGCTGACTTCAGGTGGTAGGTTACCGATCGTCTGACTTCTCTGCTTAAGTAAGGCGGTTGCGATCAACTTTTCATTACTTCTTTACGAGGTGTTAT
ACTCGCAGCCAGCGTATCGATTATCGCATCTTCCCCCTTTTCAGATTGGCAGATGTATAGCATCCAGATTGACAGAAAGGTAGAAATCTTGTCAAATTTT
CGTTTAGGTTCAAAGTCTGTAATAATCATGCTATCGTCGAGTATTGCGCAAGAACTGTAATCTCGCATGACATTAGCACAGTATAAATAATATATAATAT
CCGAATGAGGGATATTACCTCTTTCTCGACCATACCAAAATTAAATCCCTTAGGCTGTATTGTACAGATAGAGCAATTGAAAGGCCAATGTACAACATCA
TGTTCTTGAAGTAAGGCAGCCAATACTTTAAGTTACTGACATGTACCACAATCACCGGCGATCGATCTTAATCAAAGTGCTTCAATACTAGCATTGTAGC
TACCTTAGCTTCAAGTATTGTGAAGACGCTCCCCGCATTACCCTAACGTCATCTGCCTTGAAATTTCTGATATCTCCCATCGGTTTAGTCTTGACCGTGT
CTGTATTCTCTTTTAGGATCGTGATCGCGATCCGGTCTGGGGTCAAGTATAGACATTTGTGCGTCACTTGTGCGGCTGATTTTAAGGACATCTTCATAAC
GCATTTCATACAGCACGGACGCATATATCTCGAAGTCCTTATTAAATATACTGCAGTATTTAGACTTTCCAGAAATGACTGCATTGATCTCAGCGTTGAA
GAAATGAAATGTAACCAGCGTTCTTGATTCATTCAAATTTGCTTCCGAACCTTCCAGCGTGACTTTATGGCCCACGTATTCCACCCTATGGCGACCTCAG
AATCGGTTGGCTAAGCTGATCAATAGATTTTACTCACGACAAAGTGATGTCATTGTTGTTTGTATTCAATAAGTGGAATATATTTGGATAAGGAATCCCA
CGACGTATCAGGCATGAGTATATCGTCGATTTATGATCTCCGAACCAATACCGATGGTCTCGGATTGCGTCCGATTCACCTTCAGCGAAAACATAGATAG
CCTTTGACGATCCAGCAGTGATCGACTTATTTTCTGCACCATTTATGAATATCCATACAGATCGTTATCGATCCAGCGCTGATAAATATGCGACGCGTTC
TAAAAATTAAAAGGCAACTATCCACTTGAACAAACCTTACGGTGTGATAAATGCGGGAGATCAATTTTGGCCGTTCTTTCATCTTAACCACCCAAACCCA
CTCGTCATACTAAGGGACCATTACCACAGATATTTATCTAATCTTGCAATAATGTCACAAGTCAGAGGCATACATCACACCATCGATCGTGTCGACAGGT
TCACTCAATTATAAGTAGTACACATCATTATGTCTTCGCCATATTTCTTGATTTTTTTCATCACCACGACCGGCAAATCCTACTGTGAGGAGGGTGGCTG
AATGTTATTGGCCTATTATAACTCTTTAATTAGATCGACAAGTTTTCTTAAAACTTAGGTGTTATAGGCCATACCCTTTGCGCATCCGGTTCTGCCCCTC
TTACATCTATATCACAAAGTACCCCACGCGTTGCAGGAGGTAATGCGTCCATTTTTTCAATAAGTAAATGGCTATTCGTTTAAATTAATTATCGCAACTT
TTCTTGATCGTCTGTCTTTTAGGCGTCTGGGCTGACAACTTCAATTTATCAATCCTTATTTCTTTCTTAGGAGTTACAACTTCTGGTATTACCGCTATAT
GCCAATCGACATATTCAGCGAACAAATCACCGCCGTCATGATAATACATC