Description :
From Genome Similarity Track
Location :
Scaffold_266:3097- 11839
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_266-fgenesh-gene-0.1Ankyrin repeat protein
Pytiw_DAOMBR242034maker-piw_contig_266-snap-gene-0.15Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_266-fgenesh-gene-0.6Calcium-dependent protein 5
Pytiw_DAOMBR242034maker-piw_contig_266-fgenesh-gene-0.2Catalytic/ coenzyme binding protein
Pytiw_DAOMBR242034maker-piw_contig_266-fgenesh-gene-0.7Conserved gene of unknown function

Sequence
8742 bases(100 bases per row)
CGAGACGCTGGTCGAGGCGGCCGACGGGTTCTTCCTGGCGGCGCGCCATGGCCGCTCGGACGTGCTCAAAGCGCTCGCGGACCACGCGCGCGGCCAGTTG
GACCTGCGCCAGATCGTGGACCCGGCCACGGGCCGCACGCCGCTGCACGTGGCCGTGGCTAATGGTAAGACGGACGCCGTGCGCGTGCTGCTCGCCGCGG
GCTTTCCCCCCGACCACGAGAGCCTCTCGAATGGTCGCGTGGACACTAAGAGCAGTACAGCCACAGCCACAGACGTGCCGCCCCAGAACACGGCGTACCT
GCTGGCCCAGCAGCTGCGCGCGAGCGACCTCGTGTTCGTGTTCCACCAGTTCGCGATCCAGCAGATCGCGACCAACAATGCGGACGGCGTGCGTCAAATG
CTGCGCGCTGGCGTGGATGTGGAAACGACCGACGGGCCCGCGAGCAACACCTTTGTGCACTGGGCCGTCACGTGCTCTGCGGCCCAAGTGCTGGCGCTGC
TGCTGCAGAGAGAGGACGTGCAGCGAGCCAAGGTGATGGACAAACTCAACACGGAGGGCGCGACGCCGCTGCATCTCGCGTGCAAGGCCAGCGACGTCGA
GTGCGCGCGACTGCTACTGCGCTACCACGCAGACCGCGGCGTCCAGGGCGAGAAGGGAGCGTTCAACGGCAAGACTGCGCTGGAAATGGCCACGACCCAG
GAAGTGCGCGACCTGTTCGTCGCTTATAGCGATAGCAAACCGTCACATGAGCAGAGCGAGCCCAGCGAAAGCTCGCCGTCGTCACCGCCGTCGTCTGCGT
CCACCACCACTGGCGAGTCCGCTGGCGAGGACGACAACGCGAGCGCGGCCACGACATCGCGTCGCAACTCGCGCCGCTCGTCGGAGCAGGAAGCGCAGGG
CGCGCGGCTGCTGGTGCAGCTGGAGGAGAAGGATTTGCTGATTGCGCAACTGCGGAAGACGATCGAGACGCTCGTGGTCGAGTCGCAGGAGATCCGAAAG
CTCGGCGACGAGCGCGTCGTGCTCGACTACGTGCGCAAGCTGCGCGAGGTGCGTACTTGAGTCGTTGTGTTGTGGTTTCGCAGGTTTCGCAATGCTGACG
ATGCCCTTTAATGTGCTACGTTGTGTAGGAGAATGCTATTCTGCAGCGCAGCGTGGAGGACGCGGACGAGCACATCCGGATACAGCAGGAGCAGCTGCAG
CAGCTCAAGTCGGAGCTCCGCAAGGTCGTGACTGTGGGCGACGACACGGCCACACAGGAACAACGCCATCACTTCTACTCCACAGAACCAGCGGCAGAGA
TCAATGAGACGACTCAAGCAACAGCTCCAGGCGAGAGCGCAACGAACTCACTGCGTCTCGACGCCTGTAGTGATGACCGCGCAACGAAACACAATTGGAC
TGAAAGACCACCACTGAGTTCCAGCAGCTCCACTGACTCGACGTGGGGGAAGAGCGTGCTGGGCGGACTTTGGCCCTTTGGGAGCAGCGGCGATGTGCAG
GACATGGATGGTGAAGTTATTATGACAGTGTAATCAAGGCTGGTTTGGTCTCGAACGGTGTTGAGTGTGTCGTTATGAAAGGCTAACAGGCTGGAGACGA
GTTCGCGAACGCGCTTTTCCTGGGTCCAGTCTGCTGCTGCTGCTGTTGCTTGTACACGCTTGTGAGCAGCTTCTCGCGCTCTCGTGGGGCGTTGTAGAGC
GCGCAGTTGTTGGCGCACGGCCGCTCATAGAATGGCGATGACGCCATGTTGCGAGCGCACGAACAGAGTGCCGGTGTGCCCATTTCGATCTCCAGTGCGC
TCAAGAACCGGCTGCGAGTCGCCTGATTCCCGCCTTTGCGAGCTGAAGACAGCGAGGACGAGGATGCTGACAGTGTGCCCTTCTTCCTGCGAATGATGAC
GAGGCTGTGAGCCACACGCTTGGATGAATGCTAACCGTTCGTTTGGACTTAGCTCACCTCCACGGAGTCGAAGACGAAGCCACCTGCTTGTGCAGCCGGA
CCTCGCAGCCTAGCGTCATGTCGACACTGTTGCAAGGCAGCAACCGTAAGCACCCAGTCACCACTTAGCAATGATTCAGTGGTCCACGTACACTTTGACG
CCACCTCCAGACTGGCGTCGAGGCTCGTTGGGCTCACTCTTCGCTCGTGGAACCACGAGGAACTTAGGTATCGCATCCCCAGTGGCGAGTGGAGGACGTG
ACGAGCTTGAGCCCAGAGGCCGACGAGCGTCAGCGCGCTCTCGTTCCATGTACCGCCTGCGCACTGTTGCATACAGAGCCACTCGCTGAGGATCGTGACA
ACAACAAAGACAAAGCGTCAACACCTTCACGATATCAACGTGAGAAGGCTGGGATTGCGAGTCAAACCTGCTTTGGCAGCAGCTCATGAGCCACGTTCCT
GGGCTTGGCCTCCTCGTCATCTGTTTCCTCGCTCTCAAGATCCCAGGGAGCTGAAGTCTGGTTATTCGGATCACAATCGGAGTGGCGGTGCTCTGGGGCG
AGCCTCATGGACGCGAGCATGAGCTGACGGGTGTGCGCGTCGATCCGCAGGACCTACCATCATGCCAGCAAGATTACAAAATCACGCCAGCGCAGGCTTG
GGAATGATCTCATGAGAGCGCGTACCTTTTCGATTTGAAGACCGAGCGTGCTGCCCTACAGCACAGCCGAGAAGAAGAATCAGATCAGTAAAAGCCGCCA
TCATCATGTGCGACTCTCTTGTGTTGGAGACCTTGAGCAACTCGCTCTTGCGTTGTGTCTCAACGGAGTCAGTGACTGGTCGAGCAGGACTCGTTGACGA
CTCGCTGAGATCACCTTTCGGCCTCGTGGCTTCGAGAACTTTGATGAATTTGTCGTCCTATTGCGAGGTATCCAAGAGAACGAAGGTGAGCTCGATGGAG
TGAGGACACGAAAATCAACATCCCCCCTAGAGCAACAGACAGACCAGGAGCTTGTCCTGGTGCTGAGTCTCGAGCCGGCGTTGCTGCTGCTTGTCGCTGA
TGCGCAGGCAGATCTGGTCGTGGAAGCGCCGTAGCTGCTGCTTCTTGGAGCGCAGGCGCCTCTCGCTCTCGCGGCGCTTGGTGTCCGTCTCGGCCTGGTG
ATCAGTTGTACCAGCCATTCATAAGGATCCCGAGAGAGCTGGATATGCGTGAAAAAGCTATGCCGTGCCTACCTTGACGTCGACTAGGTCTTCTTCAGGT
TCGTCCTCGACCAGTGACGAGAACCCATCGACAAAGTCTGCGTTAAGCTCCATCTGGATGGACTGGTCGCGAACGTCCCTAGGGCAATTTGTGGGTCTGA
GATACTGAAGCCGAGACAAAAGTCGGAAGCCCAGCGTGGTCTAAAGAGCCGCGCCACTCCAAGTCCAGAGAGTCGCTTCCTGCCTGTCGTGAAAGAGCTC
AAATCCAGGCTTTGGCTCTGATTTTAGAGCTCCCTTGAGAGCGATAGCGATGCCGCTGACACAGCACTACTACACGCGAGATCCGATCGAGAACTTGCGC
ATCCACGTCACGCTGCGCAAGGTCCACTAGTTTTTATGTACCCAAGCCTTACTGTAGACGCCTATGAGATGAGCTAACTGACTCTGGTTCTGAATTTCCA
GATCTTAAGCAACACTGGAGAAGCCGATCTGAGCTCGGAGCCAGTGGGTCACACGTGGGATTATTGCTTCAAGTGGCAGGAGAAGAAGCTGACCAGCGCC
CAGCAGCACGCACTTCAGCTCGCTCACAGTGCGAAGAATCGAAACAAGGCCAGCAAGAAAGTCAAGAAGGTGAGGATCTTGTACAGCATCCATCTAGCGT
TAGCTCAGCTTACTGCAACACATCACCTCACTTCTACAGAAGACTGATACCGACGCTAAAGCTGTCACCAATCCCGCTTCTCCTTCCAGCTCGATCTCCC
AGTCCTCGGTGCTCTGCTCATACATCGATGCAGACAACTACGTTCCAGCAGAGGTAGCGTCCCCAGAAGCAGCCACCCATTCCAAAATCGCTTGCTCTAT
CTTCTAAACGCCTGGCTTTGTTTCATAGGACCTCGCTAGGCACGTGACGACACCGTCACACTCTCAGGCCTCCAATGAGAACGACCGCAGTCCGCCAACG
CATCTTGTGGGCGCTCGCCAGCGCCGACCACCGCACGAAACGCCCTCGAGACGCAACACGGAGCACGCGTGGGCGCGTCATCACCGTGAGGAAGTCTACA
GAGCCATGCACATCGTCGTGGCTCTCGGTCCGAGCAGCAGTCTCGAACAAGTACTTTGTTCGATCCAGTTCTACGCCGACACTGGGTTGCTGAGCGTCAC
GCCAGGATTCTCAACTCCACTGGACCTGGATAACGACCCCGACGCCCTTATAAATGGACCCAAGCTCACGACCTACCGCGTGTCGATGAGCGGAGCGCAG
TACGAGTACACACTGGACAACGTAAACGACCTCCTGCCTCTTGTGGCGACCTCCGACCAGCAGCTGCTGCGAGAACTCCAGATCCAGGACGAAAAGCAGG
ACGCTACGCGCGTCGCTCTTTTAACCGGATCTGGAGACCTGAGCCAGCAGCAGCTCTACTACGAGACCATGCGACTCAGTGGCGTGCTCAGGCGAAGACT
GGTGCTCGTGGAAGTCGTCTCGGCGCTCAACCTTGTCTGTGGAGCGAGTGATAATGCACCAGTGTTCGTCGAGCTCCATGTTCAGTTCCCCAAGTTACAG
CAGCAAGCGCACTGGCGACACCGAGTCCTGGTCAAGCCTGATGCTGTGGCCACCAGCCAAGCTCCGGCGACGCAGTCTCGCCTGTCCCTCATTAAGACTG
AAGCGAATGGGAGCACGCTCACAGTGTTCAACCTCCACACAAAGATCGACCTAGAGCTCTGCAAGCCAAGTGGTGGACGAGAAAAGCTCGACGCTGCTGA
ACCTGGTGCTGACGACGACCTTGTGGTGGCAGCGGCCTCGCCGGTGCTCTCGCTCAGCATCTTCTCTCAGGACTCATGGGGACGAAAGCGCACCGAGGGC
TTCGCGGACATCGCGACTCCGCTCACAGTTGGACACCACGACCATCTCGTGCCCATCACCAAGCCGATTCTTAGCGTGCGAGAGCAGATGGAAGAGCTCT
TCCTGGGCGTTGATGAGAGCCAAAGTTGCGATCAGCTGAGCTCTGAGAGCACGACGCGTCACACTGTGAACAGTCGACTTGGGATCCAAGCCCAGTCCAC
GGGCGCGTCGATTCGGGTTCGTATCAACATTGTCGACCAGTCTCCACCACTGGCAGTAGCCCAGGCGTCTTCGTCTCATCCGATCCACAAGCGAGGCGTG
CCAGTGCTGCCTCATACGTCACTATCTGGAGGCATGCAGGTCGTGAAGCGCAGCGTGAACGAGATCTTGCAGTCCGTACGCCTCGAGAAGCGCATTTCCC
AGGCTAGTAGTGGCGATCCAGTCACGCCCCAGTCCCCACTGAGTGCCTCAGCAGCTGTGAACTCGGTTCTCGCGCGGCTCAAGCCTCAATATGAGTGAAT
TACCATCTCATTTATTCCCCTTAATGCGATATTCACACGCACTATAACGACTCACTCAGTCGTCGTCGCTGTCGAGGTCGTCCAGTGGGTTGCCCGAGCG
CTTCTTCATGACGCGGAAGAACTCGTCCTCGTTGATGAAGCCGTCGCCGTCGCGGTCGGCCTCGTCGATCATTTCCTGCATCTCGTCGTCCGTGAGCGTC
TCACCCAGCTCAGCGCACACGCGCTTGAGGTTGCGGAACGAGATCTTGCCCGTGTTGTCGTCGTCGAAGAGCTTGAAGATCTTCAGGATCTCCTCGCGCG
GGTCCCTCGCATTCTAAACAACCAGTACAGTGAGCTAGCTCTCAGCATACTGAAACCAAATGAAAGCGTACTGTTAGAGGAAGCCAAACGCACCATCTTG
CCCGTCATCATCTCGATGAACTCGTCCACGTTGATTGATCCGGACTCGTCCTTGTCGATGTCGGCGATCAGCTGGCGCACCTCGGCCTTCTTGGTCTGGA
AGCCCAGCGCGCGCATCGCCGCCTTGAGCTCGCGCACGTCGATCGCGCCGCTGCCGTCCGTGTCGAAGAGCTGGAACGCCTCCCTGATCTCCTCCAGGTC
CTCGTCGTCCAGCGCCTGTGCGTCGCACACATGTTACCTAGGATGTGAGCTTCCAACAATGGTTCGTATGAAGTAGGATACCTTTTTGATCTGGCGAGGC
TTGCGCCGCAGCGCAGCACGCGACCGCGCGAATGCAGACGCCGACATGGTGGACTGCAGGCGTACACAGACAGCACTTGTCAGTTGACCATAGTCTCACA
CACATACGTCCTCGTGCACGAAGAGCTGCATCACCATTCGTGGCTCGTAGCAACAATGATCGCTCTCAATTGCGAATGGCGTGACCTTTCGTGTTCCCCT
TTTGTGAACTGTTTTAAACATATCCAGAAATGAGCAAAATTTCATACAATTATCAATGTTAAAATAATCTATTTATGGCCGAGCTGTTTTTGAAGCTTGA
AAGTTCGAAAAACATATTGCACCCCTTACATATATCAAATTAAATACGGAATTGAACCAGCCAACTGATTTTCAGAACACAAAAGATCACTCACTGTGAA
ACCGATCGAAGCTCTTTGTCATTCCGCCATTCGCCACCAGCAGCTCTCGAGTGGCAAGCATGGCGTCCACGACCGCGCGGCAGCTGCGCACGAGCGCCAC
CAAATCGTACGACAAGAGCAAGCACCGGCTGCTCGTGATCGGCGGCAACGGCTTCGTGGGCAGCAACATTTTACAGCGCGCCGTGCAGAAGGGCATCGAG
GTGCGTAGCCTCAACAAGTCGGGCAAGCCGCAGTGGCAGGACGTGCCCTGGATCGACCAGGTCGAGTGGCACCAGGGCGACGTGTTTAACGCCGAGGACG
TCGCTAAGGCCGCCGAGGGCGTCACGGGCGTCAGTGAGTGACGAAATTTATCGTATTAGCGCTTGCTTGCTTGTATTGAAGCTCATGCTCTACGTTGATG
TTGCCACAGTCTCGACGGTTGGCGCATTCGGCAGCAACGAACTCATGGAGAAGATGTGTGGCGACGCGACCATCGCCGCTGCACAGGCTGCGCAGCAAGC
AGGTAAAGTGGCGTGGTGTCATTTACTTGAATTGTGTGATGATTGCGTTATCATGCCGCTATGACGTACAGGTGCTGAGCGATTCGTGTTCATCTCCAAC
TCGCGCGTGGGCTCGCATGTGCCGACGTGGGCACCGCTCTATGGCTACTACCACGGCAAGGAGCGCGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCGCTGTCGCTGCGCGGTACGCACTCTCTGTCTTAGCGCATACAGACAA
TAGCTCTGTGCTTAACCTTGTATCGGTGATGTTATCGCTATGACAGATTCCCAAAGACGGGCGTGTCGCTCCGCCCTGGGTTCATCTACGGCCTGCGCCG
CACGAACTCCTACAGCGTGCCGCTCCAACTCGTCGGTGTGCCCATGACGCTGTTGTCGCGGGATCTTGGCGTCGTATCGAAAGTGGTGTCACTCATCCCG
TTCGTGGGCGACGAGATGCGCGCGGCGATCCCCGTGAGCGCTGTCGCGAAGGCCGCCGTGCTGAGCGCGATTGGTCCAGTGCACGGCCAGACGCTGGACA
CGACCAACATGCTCGAGCTCGCTGACTCATTCCACAACACGCTCTAAGCTATTAGTCGATCTCCAGTCCTCATTATCGCAAACATGGCTTTGCTTTATTG
TTTTTCTTCTATCTGTTGGCCATTGCATGTGCTGTGTACTTCATGCCCGAGAGCCCGATCTTCTTCTTGCGCTCCTCGGCGTCAGCTTTCCGCTGCTCGA
GCTCGCTTGTTCGGTCCTTCCAGTATTTCTATATGAGCACACAGCCAGGTGTGCAGGTTAGAAGATTGGACAAACGGTATGTGGAGATGGCAACGCACCT
CTTTTTGCTTCTCTTCCTGCTTGGAGAGTTCCTGCTGCAGCGCCTTCGAGTCCTCCTCGGTGGCCTTGGACATGGTGCTGAAGCAGATCTCGTCCAGCGT
TTGGACCTAGCGCATGTAGCATTAGCACGAAAGCAGTGTCCACACAGCCACCGCGTATTGATACGCTAAGGCGACGCACCCACAGGTCTCGTATCGACGA
CGACTCGGCCGTGAGCTCCAGCAATTTCTGTCCATTGGAGCCGAGAATCACCAGCTCCAGCAAACCTGTGGCGGCATATAGAGCAACGCACACACAATGA
GGGCTAGACAGACACTCAATACAGTGCCTGTGGTCGTACCATTCGAGCACACCTTGCCAATGCGGTAGACGGGGATCTCCTCCGCTCTGCTTGAGCCCGT
GGAAAGCCTCCAGAGCAGTCTACATACAATAGATCACACGTCAGCCACCACCCATGGGGGCAGTCAGTCGACACACGCGTCACGTACCTTGTCGCGCTCG
GGTTGAGCTGCAGGTAGATGTGCTCCGTCTTGCTCAACACGCCCAGGTACGTGCTCTTCTTCTTGAACTCGCTACCCTCCTTGAGCAGCTCCTGCCGCTG
CAGCATCTCGTAATTGCCGCTGCCGCAGCACGCGTTCCCCAT