Description :
From Genome Similarity Track
Location :
contig_47:309626- 317428
Transcript NameFunction/comments
g7883.t1hypothetical protein PHYSODRAFT_542020
g7884.t1hypothetical protein PHYSODRAFT_285506

Sequence
7802 bases(100 bases per row)
ACCGACGTCAGCGCCTCACATCCAACATGGCGTCCAAGCTGCTGCGTCGTCCGCTGCTTGCTCGCTCCTCCTTGGCGCGCAGTTTCAGCGCCGCCACCAC
CGACCAGCAGCGTCGCGTGTGCGTGGTGGGCTCGGGTCCTGCTGGCTTCTACGCCACGAAATACCTGCTCAAGGAGCACTCCGGCGCGCGCGTGGACATG
CTGGAGGCGCTGCCCACGCCTTTCGGTCTCGTGCGCTGGGGTGGCGCCCGACCACCCGGAGGTCAAGAGTGTCATGAACGACTTCGACAAGGTGGCGGCC
GACGAGCGCTTCCGCTTCCTGGGCAACGTGCGTGTGGGCGAGGACGTGACGCTCGCCGAGCTGCAGCAGCACTACCACGCCGTGGTGCTGGCCTACGGCG
CCGCCGGGGACCGCGAGCTCGGCGTCCAGGGGGAGCACCTGCATGGTGTCATGTCGGCGCGCTCGTTCGTCAACTGGTACAACGGCCACCCGGCCTTCCG
CGACCTGCAGCTGGACCTGCAGCACGCGGAGACGGCGGTGGTCGTTGGCCAGGGCAACGTGGCCGTGGACTGCGCGCGCATTCTATCCAAGAACGCTGAC
GAGCTGGCGACGACGGACATCGCCACGCACGCCGTGGAGGCGCTGCGCAACAGTGGCGTCAAGAAGGTCTTCCTGGTGGGGCGGCGCGGCAGTGCGCAGG
CGGCGTTCACGATGAAGGAGATCAGAGAGCTGACCAAGCTGGACGGCGTGGCATGTATCGTGGACCCGGAAGATCTGAAGCGCAGCATGACGCCCAACTC
AGAACAGGAGATCAAGGAGCAGCGCGCTCGAAAGCGCATGAGTGATTTGCTCGGCAAGGCGGCGGAGCGATTCGCCGGCACCATCGACGCTGAACGCGTT
GTGCAGATCAAGTTCTTGAGTTCGCCTGCAGAGATTTTGGCGGATGAGAAGGACCCGACTCGAGTGGGAGCGATTCGCGTGGAGAAGACGAAGCTGGAGG
GCGAGCCGAACCAGCAGCGTGCGGTTGGGACTGGGGAGTTTGAGGACATTCCGTGCAACCTCGTGCTTCGCAGTATCGGCTACAAGTCGCTGCCCATCGA
GGTCAACGTACCCTTCGATGACCGACGCCATGTAGTCTCGAATGAGCAAGGACGTGTTGTCGCAACGTCCGTTAGCGGTGAAAAGCAGCCCGTTGTGGGC
CTGTACTGCACTGGTTGGGTGAAGCGTGGCCCCTCTGGTATTATCGGCACCAACATTTTGGACGCACGGGAGACAGTAAGCTGCATCGTCGAAGATTTTG
CAGCAGGCAACTTTCTTCACAGCGATAAAAGCTATGGCGAGGACTTGGGTGGATTGGAGACTGTGGAGAAGCTCATCAAAAAGCGTAACCCAGAGAAGCA
GCTAGTTAGGTGGGCTGACTACGAGCGTCTCAGTGCCGAGGAAAGCCGCCGCGGCGAACTTCTCGGAAAGCCGCGTGAAAAGGTCACGTCTGTGGCGGAG
ATGCTGTCGATTGCAAAAAGTATGTGACTAGCTGCTAAGAAAACCCAAAGATGATCTGCGGCAAATACTGAGTAGCGGTGCGCAAACACACCTAGAGAAT
CGATTTTTATCGATGGTAAAACGTCACTTCTTGGAGCCATTGCGCTCTTTTTGGCGAGTAAGTGCAGCATTCGAGGCTTTCAGTGCGCGAGTCTTCTTGC
GCTGCAATACCACCACAAGTCAATTGAGATTGAACCCGTCAGCTCGCGTCCTCATGAGACTGTAAGCAAGGCGTACCTCTTCTTCTAGCAGCCTCATCAG
ACGCCTGCACTCCGCTGCACCTTCAACCGTGTCGTCCTCGTCCTCGTACTGATTCATCACCCTAGATCGAGCCTGAGTTGCGCCATGTCGCTCTTCATGT
GCGTCTTGTTCATTTGCGTCGAAAGCAAAGGTGTTAATGAAAGGCTGGTTCACTCGATCACGCAGAGTTGCCGCGTAGGTTGGTTTAGTTCTTCGAACGG
GGGCGGAAACTGGCCGTGATAGTTTGCTTGCCGAAGATGCCAAAGTGGCAGAACGTGGGTGTTGCAAAGGAAGTCGTGCTGCTGCTGTCGCCATCTATTC
GCACGACGATGCATTCGGTTAAACGTGCTGCTAACATCGGCAACGATGCAAAACATTCTGCTCGTACGATGGCTTTCACATGCCGCAGCTTCGCAGGATC
CGCCAGAATATTTGTTGGCAATGAAAAGGCTCTGGGATAGCATCACCGAGGTTAGCTGCGCCGTACAGCAGTATCATAAGGAAGATAAACTTGAGTGGCG
TTCGCCGCTGCTCGTACCGCTGGCTTGTGTCCACAGCGCTTATGAGCCGCCCAACATACGTGTACATCTCCAAGCAGTCCTCGCGGATATTCTACGATAG
AACAGTGAGGCATCAGAGGATGGTTTTAGCAAGCTACAGCACCAACACTTTACGTACATCCATAGTATCAGTAGTGGACTGCTGTAGCTGTGATAATTTG
CTGTTTGTAGTGTTGAGCTCCTCTGTTTTGCTTTTCAAAGACTGCTCATACTGTTGAGTGCACAACATTTGTCAACAACTTCTGATGCAACGCAGCTTCT
GTCCAACGTACCTGCTGGCGAATGAGAGCGATTTCATTCTCTTTCAACTTTTGCAACGCAGCTACTCGTTGGCGTAATTTCTGAGTGAGAAGGGCATGAC
ATATATATTCGTGAGTTGACCGAGAGCATGGAGCAACGCAAACAAAGCCTGGCCAACCTGGTCGAACTGCTTTTCTGAGGAATCGGAAGTATCCACGTGT
GGATTGATGTTTGAGGCTTGATGCTGATGATAGGGAAGCTCGTTATCCACGCTGGCGCGCATCTGGTTGTTTCGGCTGAGGAGCTCCATCATTTCTGCTC
GGTGCCGGGCGGCCTCTGACGCCAAAGCGCGCTCATACTCACACGACTTTTGCTTCAAACAACTTTCTAATGTAGCAATCCTCCGCTTCTGCTCGTTGAC
GACACGTCGTGCATTCTCTTTGTCTTTCTTTGCTTCAGTCTGGAGATAGTAAGATTACGGTCGTCAGCGAATTGGAGATCAAGTTGCCGAAGATAGCCAT
TCCTCAACTCACCACGACCACAGTGAAATTACTCTTTGCATTGGTGTACTTCTGTCGTAATCGATCCCGATCGGTCCTAGCATTCTCTGCTGTTGCGTGA
TTCAAAAGTAAAATGACGGGTGTAAAGATTCATAAAATTTGTTCTACGATACCCAAACAACTCACCGTTGGTTCTCAATAAACCTTGGACGTGCCCTGCA
GGCCCAGTGTGCCTGTTCTTAAGACATGAGCTTGAGGTTACTGTACGGTCCCCTTGGTCTTCATCCGAAAACACTGACTTCAGCACGAGTCCGTCCTACG
TTCACACACACATAGCAGAACTGCTGGGTCAAACCAAATATTCAACCAGTTAGATATGTGCGACCTACTGCAAATTTGATTTCGCCGTTTTCCGAGATCT
CTTCAGCCTGGAAGCCGAGTTCGTTCAGTGTGGAAACAAACTTATTGTTGTATTCCGTGCGCAAACCCTCAAGCTGACGGCGCAAGACGCTCAGCTCTTC
TTGAAGCTTACGGATACGCCGATCCTTGTCCACAATTGTACCATTTATATGATTTACACGGGGCTACGCAAATGCAACCACCAGGTTAGTCGCAGCAAAT
GAAGAAGTACGTTTTGCATTTACTTACCTGGTTCTGCACGGAACGGCACCGGTTGGCAAACTGGAGGGTTCCCAGGCATTCTTCATAGTGCTCCTTCATC
GGATGGATAGTTGCAATAAGTGTGGTAAAACAATTTCCTCCTGCAGCCAAAAGTACAAAGCAAAGGCAAGTTAATTAAGCAATGCAATCAAGGAGTAAAT
TTGCTTCATGCACGAACCGATGCTGTTCTGTAGAAGTCGCGTTAGTTTCGAGTCCCGATAGGGGATGTAGTTATAGCCGCTCTCTGGATCTAGTGACATC
ACAACTTTGCCCACGGCACTCAAGCTCGAGTTAATATGCAATGCCTCCTTGAGGCGCTGGCCATCCGACTCGCTCTTTTTCAGGCGCTCAGACCTAGCAC
CACAAGAGCACCGATGTCAGAAACGCAAACAGTTGCTGGGGGCTGCTTCAAAAGGACAAGTATGCACCCTGCTAGATCCACCATGTTGAGCATTCCGTAT
ATCACTTCCTCGGTGTCTCGAACTTTACCCACGCCATAGAACCCAAACAAAATCAAATTCAGGTTCTGTCAGATAGCAAGCAAGTTTGTCTGCATCACCT
TGTTGAAAGACGTGGATGGTAAATACCGTGTGCGAGCGCGACGACACGGCATTCATTTTTGTTTCGTGCGTTGACCGTAGTTTCAGACCGCATTGTACAA
TGGCGTCCACTTCTTCCCGTGAGGTTACGGTGACCATCGATAGGTCCTTCACAAAAACTCTGCCTTGAGCATCCTCGTGAATCTCGTAGTTCGCTAGGAC
AGGAAAAACGCAACAAGTCCAGGAAGGCGAGTTAGTTCATGAGTCGTGGTGGAGATCTTCAAGCCGCATTTGACATCAAACGCTGGCCCTCCCAACCTTT
TTCGTAATCGTCGTCGTCTTCCGCTTTTGGTGGGTTCGAGCTAAAGCTTTTTCACAAGCACAGAATGAGTGAGTGATTCGATTGCGTATGTTGCACGTGT
TGATACAAGCATACCTAGCAGCGCTCTCTGTTCGAGGGATCTGCTGCTGTTGCTGCTTGTACAAGGTTGCACCACGGTGAACCTGTCAGCAACGCGCCAA
TACGTGCGAGGGATACTTTCACTTACTTGACGAAGAAACCATTCAGCGCTACTTGACGTCTGGTATGACACCGGCCGACCTGCTTTCTTCAGATAGCTAG
AGTTCTTGTCAGTTGATAAGCAAACTAGAAATTGAGCTTCAATTATCACGGCACTCACGCTCGAGCGAGGTCACGGACGCGATCGCAGTAGATTTCCAAG
AAACTAACCACGAGCGTCACTTCCTGTTCAGTAAGCGTCAACACCACCAGTAAATAACAGCCAATGTTCGCATGAAATTCCACGTACCTTGGATTTATTG
GGTTGACGATTAACCATGTCGAAGAGGTATTCAATAGATCGTGATAATAGCCCCGCCTTCTCTCCTCCCGGTTCACCAAAGATACTGCAGATGCACAGAA
GAAAGCACCAACCATACCATGTTATTCTTTCACTCATCGCGATGGCGATACACACGTTGTGATGCTATACCTGAAGGTTTTACCGGAGCCTGTTTGACCA
TAGGCAAAACAACAACTGTTGATGCCTTTCAGTGCGAAGTCCACTAGAGGTTTGCTCGTCTACATTCATAGATCCAGACGCTCAATCCTTGTCAGCCTGT
AGATAAGTAAAATTGTGTATACAGCACACTCAGGATATACCGCTTCAAACAATGTTTCTTGAGTTGTGTCGGTCCAATAGATCTACAACCAACAGATTTT
GGTTTTAGTGCATCGGCTGGGAGTTCTCGTCACAGAAGTTTAGGTTTTACATTGTCGAAGCTAAACGCATGGTTTCCGTATTGCATCCGTTCTGTATCCT
AAGCAGCACCAAATAATCAGGCGTGAACTCAATACCGTGTAAAAGACCACCACCCTGTATGTTTCCGCACCTTGATCACGATATTGCTTGGAGTCTCCTT
CTTCCGCTCGAACATGTCTTCGGGGGCACTTTGGCCGTCAGCACAGGGTCTTGCGCGAACATACACCTGCAATGAAAGCACGAGCAGACGATGGATCCGT
GGAGCTCAACAGCACACTAAATACTCTGCATGTAGAAAGCTATATCCAACCTTGACGTTCGCATTCCCGAGCAACCGAGTGTAGTCGGTAGTGACCTTGT
GGTCCATGACAATAACTTCTGTGCTCTCTTGGTCTAGATAACGACGAGCAGAGCTTTAAGATCGTTGCTTGGATGCCTCACGGGGGTATTTTCAGTTCGC
GTTTCGCTCGACTTGCCGGCGCCTCTTCATTAGAAAGCTGCAACGCTATCGCAATGGGGGTCACCACCAACAGTACCGCGCCGAATAGCTCGGTCGAACA
TCTGCACAATGTTCTCGCGTATATCCAACAGCTCAGTGCTCAAGCTGCCGACGGGGGCAGAGCTAACAAGCACCAACAGATTCGAGTCACGCATTGGGCG
CGGAAGCTCCGCAGCCAGCCCACGTCAAACCCTACGTGGTTGAAAAGTGTGCTGGAACATGCTAATGTGCTGCTTCAAATGCTGCTAGAGGGCGTACGTG
TGTGTCATCTTGGATGTAGTAATAACGTTACAAGTAGATGCCAAGATGATGCTAACACAGAGCGGTCTTAGGCGGTCGAGGAGCCTTTCACGAAAATGCC
GCCCCAAGGGCCATTAGCTGCACTTCCAAGGTGCCAGGTGAGACTCCGTGACGATTCCCTGTTTAATCCACACAACACATTCATTACCTACTTTGACCAG
GTTGCACGTCTCGCAAAGGCAGCAGCGCATTTCATCAGATTGCCAACAGACCGCACTCGAGCAGTACCGATTGGGGTGCAACTCAAGCCACCAAGACAAA
CAACACACAGTAACAATGCAGATGAGAGCGTACAAACTGTAGCTGATGTTCGGAAGGTAAGTCAGCAGGTCCAAACCCAAGAAGAAGACGATCAGTGGGA
ATGGCAGCGCGTCTGGAAAGGTGCTTTCGACAAGATGCGCCAGCAGCTACAGCAGATGACAGAGGAGACCGAGGCACTAGCCACCGAGAACAAGGTGCGG
TATCGTACTCCAATGTGAAGGCTTCTATCCCTTTTTGATTCAAAACTACCGGTACGCAGGAGCTGCGTGCTCTCGTGGCAGGCTGCGAGAAAGCTCTGCA
GGAAGCCGATCGGACTCAGCGCGACGTTGTGGCCAAGCACGTCGCCGAGCTGGACAACCTGCGCGCTGTCCACTCCTTGGAGCTATCGGATCTACAAGCT
CGACACCGGCAGAAATTGCAGCAAGTGACTCTGCAGAACGACGAGAAGTTGCTCAGCAGACGACAAAGTCGCTTCATCCAGCCAACACCGAACAGCAGCA
ACTCTCCGGTGCGTACGCAACTTGTATATTATCTAGTACTCGTCTTACCGTTATGTCGTTGCTATAATGCTCAGCCCGACGCCAACGCAGACTTCTTGCA
GTACATCGACGCCTTCTACTCGGCCACTTTGCACCTCACGGCGCAGAACAAGGCCTGACAATTGACCAGCATACGTGGCAGTCACTTATACTTGGATGAA
GTATACATAAATCCGCAATTAGCACATCCCGTCACTTTGCGATAGAGACTAGAGACCTCATGTCGACCAAAATGCTGCAGGGAGACCCGCGACGTCCGGG
CGACTTGCACCCGTTCGTGCGCGAGCAGGTGGACCCCGACGACGCCCCAGGCGACTGGTACGCCTTCTTCTCGCTCGTGCTGGGCTTCCTCGCGTTCACC
ATGAAGGTGCGTCACAATCCCGCCCAACTTGCTTTTGGGAGTCTTATTTGGGCTAATATTTGTGTACCTTTTTCCAGTGGAAGGAGCTGGCGTGGGGTTC
GCTGCTGCTGTGTGTGGGCTCATTCACCAACATGAAGTCGCAGGACATGAACACGACGCAGGTGGCCATGTCCTTCTTCTTCTCCACGAGCGCCCTCGTG
TCCGCCTACATGGGCAATATGCGTCCAGGAATGCCCATGTCGTCGGCCCAGACGGCGGATGCCCCCGCTTCGTAGAAAGAGGGAGATGTAGGTATCCATC
AG