Description :
From Genome Similarity Track
Location :
Scaffold_32:309619- 314872
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010714Protein of unknown function
Pytul_DAOMBR144PYU1_G010713Similar to TCHH: Trichohyalin (Homo sapiens)
Pytul_DAOMBR144PYU1_G010712Similar to Myo5b: Myosin-Vb (Rattus norvegicus)
Pytul_DAOMBR144PYU1_G010711candidate b-glycosidase%3B C-terminal membrane anchor

Sequence
5253 bases(100 bases per row)
CAAAGTGACGTACATTGCCGAGGACGGGACCGAGCAGCTCGTTAACGCTACTGACCTTGGCAGCTTTTCGCTCCTGGCCCGGACGAGCGAGCTGCTGCGC
TTCTGCCAGCACCAAGTGGTCTACCGTGTCATCCTATTTGTCTGCGGTATCGTACTCATCCTTGGCGTGTACAACCAGAATCTTCGCGATGCGCTCGCGA
TTTGGTCTGGCATTACTCCTGCGGACGCGTTGAACGTCCAAATAGCGCAGAACGCGTGCATCGTGCTAGGGCTTGTGCTTTGGAAGGCGTGGCTCGTCAA
TACGAGCTGGCAAAAGCTCGTGGTGTTCGGAGTCTGCTTCTACGTGTTGTGCTCTGTCGTGCTCACGGTGCCGACGGTGTTTGCGTGGGTTCGCGAGGGT
TGGTTCTTCCTCGTGTTCACGGCGCTCTTGGAGGTGCCCAAGGGCTGGTTCAAGCTCATTGCGGTCGTGCCTGCGACTGAGATCGCCGAGCCGGGCCGCG
AGGGCGTGATCATGGGGCTCGTCTTCTCCTTCCAGGCGCTCGTGTACATCACGGCCAACACCATGTCGCTGGCGCTGAGTCAGGTCATCGGTACAAACGT
CAATGAGACCCAGGTGCGCGCGGACTCTACACACACACGGGAAACCGTGGTCGCCGCTGCGGCCGTGTACTACGCCATTAATCTGTGCAGTGTCGCGCTC
GCACCGATTTTGCCGGCGCAGAAGATCGAAGTGCAGCAGATGCGCGCGTACGGGGCCGGGAATGCCGTCATGGGGTATGTCGTCGCCGTGGCGTTCGTGT
TGCTACTGCTTTTCGGGTTGGCCACCAACATCGTGCTCGTCGGCAGGAAAGGCTGAGCCAAGGTAACAATGGAAAGACGTGAATCACAATGATAATAAAG
TATTTATGAAATCACCTATGAGTTGGCGGCGCGTGACGATCTGATCCTGTTCATCACTGTCGCGGTGCCCCCAAGTCGTTGCTCCTGCTGCTGCGCCGCT
GTTTCCGCTTCAGGATCTGCTGCGTCTCATCGCTCAGCACCTGCGCCGCGATCTTCTGCTGCGCCTGCTCGAGTCGCAGTCGTGCTTCCTCCTCTTTGCG
CTGCTTTTCATCTTTCTTGGACTGAAGCTCTTTGATCGCGATAAGGCCTCGTCGCTCCAGATCCTCCCGCAGCGCCTGCGCGTGTGCCATGCGGAGTTGT
CGCTGCTCTTCGTCGAGTCGTTGCCTCTCAAGTTCAGCGCGTCGAGCCGCCTCGCGCTGTTTCTCAAGGATGAGCGCACGCGCAGCCTCTCGCTTCAGAT
TTTCCTCGTGGACGCGCTGCGTGTACACTTGCTGCTTCTTGCGGAGCTCGTCGCGCGAGAGATCCGGCTTCTGTCTGCTATAGGTTGGGGACCTCGCTTT
TGGTTGGTGGTGGCGATGATCCGCTCCTCTTTGCTTTGCTCCATTCCCAGGCACGCCATGACGGGTACTGGTGGTGCTCCTCGCACTGAATGGATCCAGA
GGATCCACCATTTCGCCATCAGCGTCGACCAGAAGAGTCGCTAGGTCGATAGCGGAAACATTGCTGCCCTCAAACGCCAAGAGGTTCTCACTGGAATCGC
ATGCACTCACGATGCTTGCGCTCTCTGTTGCCGCCGCTGTTTCTTTTTCTGGCACGAGCGTCACCCAATACCGCACGATGGAATTGATCCAGTACAACTG
ACGAAAGCACGTGCCGATACGCTTCCGCATAAACTTTTTCCGGTACAGCGCGTGGATCAACGTGCTCTCGGTGTCGCCGACGCCCATGGCCTTGCGCCAC
TGCGTCTCGATCATCATGTTGTGGTTCACGCGGTTGAGCAGCTCCTTGTGTGAGAGCTCCTCTTTGGCGCGAACGCCCCGCATGCCGCGCAGGATCTTGC
AGCACAGCAGGCGAAAGCGGCGCAAGCGATCAAGGCGGCGCTTGCGCATCGCGCGATAGCTGCGCTGGATGCGCAGCGCAGCCTTCACAGCCATAGACTG
GTAGCGGATGCGCCGCCCCAGGTACCCGCGGTACAGACGCTGGATCTGCATCGCGCTGAAGTTGAAGTAGTTGTAGTACGTCGTCGCGAGCCACTGATGC
TCTGTGTGCAGCTTGTCCATCATCTGCGTCGTTTCCTGGAGCTCCTGCTCAAACATGCTCTGCGTCTGCTCGATGCGCTCAAAGCATGCGTGGATGCGGA
GCTGCGCACATAAAAAATCATCAGTGTTCTGATACATAGCACACATCCGTCTAATAAAATGCTTGCCTTTGCATACTGGAGGTCGTCGACAGCTCTGGCC
AGCGTCGTCGCGTTCGCCGTCGCTGGCGCGTCCTGCGACTCGAAGCGCTCCGGGTGCGCGTGGTGATGGCGGCGGCGCGGTGCCTGGAAGTCGGCGCGGT
TGCGGCTCGTAAAGTGCGGCAGCGTGAGCGTCTTGGGCGGAGACGGTGACGGCGGCAGCGCATCGCCCCTGTCACTGCGCAAAGCATCAGGCGCCTGCGC
CTGCGCCAGCCGCAGCAGTGGGAGCGACGGCGGTGGCGCGGGCGGCGGTAGCGCGCTCCTCATGCGCTACTGCGTATTGTGGGTACTTGGGGTGAATCGT
GTGTGACGACGCTTCAGAATCGGGGCGAATGACTAATTATGCAAAACCCACGCATCCTACATGAGTGCCGGAAAGCCGACAATATTAGTTATCAGGTACA
CTTGATTGCTTTTGTGTCTTGTTTACTGCCTAAACAGTATAACCGTTCTAAGAAGTATGTATTTTTACGATAACAACAAACCAAAGGGAATACGTTTGCG
TGGTAAATCAGGCGGGTAGGGGTTTCCGATGCCCATCACTGGTCAAGCAAGGGTCAGCTTTTTTTTCGAAGCGGCTCAATACTTTCACCTCCCTCCATTG
CATCCTTCATAAAATCATATCATTATTTTAATGTATTCTAAGAACAAAATACCAAATTTATTAAGCATTTCAAATCACTTCAACACATAATATTGAATCA
AACAAGGTAAAGTTGTACTTTTGAGGATACAGTGAGGGCATGCAAGGGCCACCAAACTGTATCCAAGTCAAAGAAGCTGAAGTCTACAATATCGAAATGC
AACACTCAAATGGAACTCTGTCCCCAATCGTGTGCTCTTGATGGGGATGCGCGCGCTCGAGAGGGGGAGGGCGCAGGCGTCCATGAGCGTCTACATGCAC
CCGTGCAGAGAGAGGCAGTCGCCCCTTTCAGAGATTCCTGGGCGGCGCAAGGGAACGGGTGATTCACCCACGCGTGTATTTTACTATTCTTTTCACGGTT
CACTGCGCACTTCTAACCCCACAGATTGATTAGTCATGACGCGATTGCTTCTCTCTCTTGCACTCGTCGCCGCATGCGCGACGGCGGCCACAGTGTACGA
GGCCAAGTCTCAGACTAGGCAGTGGGTCGACCCCGCGACGCCCACGGACCGCTGGACGTCCACGAGCTCGCGCGGCCGCGTGTGGGAGCTCGTGATGAGC
GACGAGTTCAACACGCCCGGCCGGTCGTTCAAACCCGGACAGGACCACCTCTGGACGTCGCTCGAGAAGCCTGACGGCGTGAACGGCGCACTCGAGATCT
ACTCGCACAACATGACGTCCACGGCCTGCGACGACGACGGCATATGCTACTTTTACATCAAAGTAATCGAGGACGAGCAGGACGTGCGCGTGTTTAACTT
GCATCGCCACCCGCCGGCCTACGAGACCGCGCACTTCTACTACCGCTCGGCCATGGTACAGTCGTGGAACAAGTTCTGCTTCCAGGGCGGGATGCTCGAA
GTGCGCGCGCAGCTCCCGGGTGCCGTGAGCAATGCGTCGGGAAACCCGGACGTGAAGCTCGGGAAAAACGGACCAGCCACGAGCAATCAGTTCTACCCGA
CGTGGCCAGGGATCTGGATGATGGGCAACCTCGGTCGCGCGATCTTCAGCGCCTCGACGAATCGCATGTGGCCATTCTCGTACAACAAATGCGAGCCCGA
GGTCTTCGAGCCGAGCAACCAGCGCATCAGCGCATGCAACACGAACCCAAAGTTCGGCCTCAACCCGCATCAGGGACGCGGTGCACCTGAGATCGACCTC
TTTGAAGGCAACGGTAAGCTCATCTCAGCGTCGATGCAGATTGCGCCGGGGATGCCCAACGACTTTCGCTTGTTCCAGGCGTCCGTCGACTTTGACGCTG
CAAAGATGTATTGCGTGTACTTCTCCGACTGCAAGACCCCAGGCGCCAACTTGGTCGACGTCCCGACGGCGTTCTACATGGGCAAACGCGGCCACAAGTC
TTGGTACCAGGGGCTTCGATATGCTCCCAACAGGTTTTGCACGACCGGTGCGAGGAAGCAAAGCTACGCCACAGTCGCTGCATCGCTCAAGACGGGCATT
ACAGAGAATGCGTGCACGCCCGAGACTTGCCCAGCGTCGCTTGATGTAAACTCGGACCTGGGATTGATCGGCGGTGTCGGATCGGACCACTGGGGTATCA
ACTCGAACGGCACGTGCTACCCGACCATGAACTCGTACCTGGGCGTGTATCTCTGTGATCCCGACAACACGAACGAGAACTGCGCTCGTCCACGGAACGC
GTCGACCACTCCGTCTGGCCTCATGAAGCCATTCAACTACCAGATGGACGCAATCTCGGCCAATTGGCCGATCCACATGGCTGGCTATCTTGACTACCTC
GTCTACCAAATGGAATGGGTGACGGGCAAGAACGGATACGTGCGCTGGATGCTCGATGGTCACCCACTCTTCGAGATTACAGCGAACGCGTTCTCCAAGG
TGCCCCAAGATGCAGCCAAGAGCAATCCGGAAAAGATAATGATCGAAGAGCCCATGTACCTGATCCTCAACGTCGCGCTCTCGAGCTCCTGGGGAGCAAA
GCCACCTCATGTCGACAGCAAGTGCCGCGGCGACGGGAAAGATGCCGAGGCCAACCGGATCTGCAACGACCTTCCGATGTACATGAAGATCGACTACATC
CGCTTGTACCAGGACCAGGGCAGCGATCTGGACGAGGATAACCTCATGCAAATTGGCTGCGATCCAGCGAGTCACCCGACGCGTGAATGGATCCTCGGCC
ACATTGACGAGTATCAAGATATCGATAACCCGGCTGTCGATGTTGCTGGAAGGGCGTTCTGCAAAGTCGACGCTGATTGCACGGTCGACCGCGTGAAAAC
CACCGTTTTGAAGACCGGGACGTGCGTCAAGAAGCGTTGTTCGTGTATGTATC