Description :
From Genome Similarity Track
Location :
Scaffold_358:30953- 32623
Transcript NameFunction/comments
Aphin_H310_07985aminotransferase

Sequence
1670 bases(100 bases per row)
AGGGCCTCACAAAGTCATCAACTGCAAAGTTCGTGCCATGCAACAGTCTGTCTCCAGCGCCATCGACGAGCTCAGCAACGATCTCATCCGTCAAGGAAAG
CCAGTGTATAAGCTTGGACTCGGTCAAAGCCCGTTTCCAATTCCTGAGTGCATTGTGGACGAGCTCAAGTACGTCGTCTCGAGCGCCTCACCAATTCCAC
AGGGCACTGTATAGAGCGCACGCCCACCAGCGCGACTACCTTCCTGTCGCGGGCCTGCCTGAGTTGCGCCAAGACATTGCGAAGTGGGCCACGGCGAAAC
TTGGAATGACGTACACGCAAGATGATGTGCTGGTCGGCCCTGGCACAAAGGAACTCCTGTTTGTCTTGCAAACAGTGTACTACGGCGACCTCCTCCTTCC
GAACCCGAGCTGCATGAGTTACGCTCCTCAAGCGAACATCGCTGGACGGTACTGTCCTCTATCATTTGCTTGAAATGCAATGCGACGGCCTTCCGTCGAT
GTGAGATCAAGTAGCGCTTCCCCGCGTTGTGATGTCTTGTGGTTTGGCACTCCTCTCGTGAAGATGGAATTGCGCAGAAAGTGCAGCACAGTATATCCTG
TGGATCTTAACCGATCCGTTGCTTAGGAACATGATCTGGCTGCCAACGTACGCCGAGGATAGATGGGTCCTTCAACCCGCCGTACTCGAAGCCCACTGTG
CAGTCGATCCTTGTAATGCTCCCATTTCACATATTTGTTCGTTCGCTGACCACGTGGCGGGGGCTAGATGCCCCGCGAATCCTCATCCTCAACTCCCCAT
CCAACCCCACGGGGTGCTCGTACTCGGCTGACGACGTATAGCCATGTATATATTTTTCCTCCCTTCTCACTGCTGGGCGGTTCTGGTATAGCTGAAAGCA
ATCGCGGGGTTGGCCAAAAAGTACCGGTTGCTGGTCGTATCGGACGAGCTGTACTCGGACCTGACACACGAAGCGCATGTCTCGATCTCGACGTTCTACC
CGGAAGGCACGATTGTGTCTGGGGGGTTGAGCAAATGGTGCGGCGCTGGCGGGTGGCGCGTCGGATTTTGGCTCTTTTCCTCGGGCCTGGACTGGCTTCG
CAATGCCATGCTCGTGATGGCATCGGAAACATACACGTCGGTCGCGTCGCCACTGCAGTATGCGGCGCGCCGCGCGTTCGTGCCAGGGTACGTCCATATC
CAACAACTGCCCAACCAACTGCTGGCTGAACGAGGCGGCACACAGGTGCCCCGAGTTGGCCGCGTACAAGAAAAAGTGCTGCCGAACGCTCCAGTTGGTC
GGCCAGTGGTGCACCTTTCAGGTCTGTACGATGCATTGGTTTTATCTTGTGAACGGTCGGTTTGCAGCTCCACAAACTCAACGTCCAAGTTCACCAGCCG
CAAGGCGGGTTTTACCTCTTTCCGTGCTTTCGATCGTATCGACAACTCCTGGCCACACGTGGCATCACGACTGACGTCGAGCTGTGCGAGCAGCTCCTGC
ACGACACAGGTCCGTCCTCGTCGAGCAAGAGTCGTCCAGACTGAATTTTGGAAGGGGTGGCCATCTTGCCGGGGTCCTTCTTTGGCCGGCAGCCGCACGA
GCTGTTTGTCCGAATTGCGTTTGTCGACTTCAAAGGCGACATCGCTATGTACGTGATAGACAGCGAGGTG