Description :
From Genome Similarity Track
Location :
Scaffold_2:30951- 35829
Transcript NameFunction/comments
Physo_127428reverse transcriptase

Sequence
4878 bases(100 bases per row)
ATGTCCCGCAGTCGGTGCATCGTGATACTCATACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACGCGGACCGCGTTGTCGTCGACTGCA
CTGTAGAGTAATAACCCGTCGTGCACCCGATAACGGTGTACACGAGCACGAAGATGCTTCGGCAGCTTCTGACAAGCTTGGTCAGAAGGCGCTGAGACGT
AGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGCGTGCACGCGACCTTCACGTCGTCCAGCAGTGACGATGTCGGGGTGCTCGATCGCATGGCGTCAATGAC
ATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAGCGCGTCAGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATAC
TCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTTCGCAACGATGCGTGGTCCGTATAGACCACGAACGGTT
TGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGATAGTTGCGCTCAGCTGGCTTCAGCTG
ACGCGATTGGTAGTAGACGACACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAAT
GGGCGATCTTGGTCGACCACCGCCAAGATCGGCGCCTCAGTCAAGTCCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGG
CGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTC
CTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGGCGCACACCGTTCTTCCCGACGAGACACCCGAGCACGGGTATC
TCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATGTGCGCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACAT
CGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTATGTCGGTGCGAAGTTGCGCACCGAGTGCAACAAGTGCGTCACGCACCTGTT
GAAGGTCGCAGGGGCGTTCTTTAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCGCGAGAGGGATATCGCTCTCA
CGCATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGTG
TCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTATGCATGAACGATGCGCCAACCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGG
GGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAATAAAGCCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGACCACTGCCGCGTGACA
CAGTACTTTGTCCCCGGCACGAGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGCTCCGCAGGGATCTCTTCCGGAAGCACGTCAGCGTGCTCCC
GTAGAATCTCGTAGAAGGGACTCGTCTTCAGCGAGTCCCCGCTCTGCTCCTCAAAGCGCTCCTTCTTAGTCTTCGCACTGAGAGTGTCCTCGCTTTCAGT
GGTGCTCTCCATGAAGAACTGCCTCAGTTCGTCACTCTCGCTCTTCGTTTTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAG
CCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTATACCGGAACCCGG
CACAGGTACGCGTCAAGACGTTCAGCGTCTCGACGTCCGGCTTCTCAGCCTCCGTCTGCCCGGCAGACATTTCCTGTAGCGTCTCGGCCCCAGGCCGAGA
CTTGCGCATCGACCTTCGCATGCGCCGTCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGTTCGTGACCTCGTCCAGGCCCAGCCGTGGCCGGGTGTTCT
TCTTGTATACCGCCGGCGGGTACATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCTCGGCTGCACAAGTTTTTC
CGGTACGGGACGTTTGCAACCGTCCGCACCGCCTGCAGTGTCGGCTCCCAGAGCCGACACGCCATCCTTACCTCGACGCCTGTTATTGGCGGAGCCCTCC
ATTACACAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTTGTCCATGCTATCGACTCCCGGAGTCGATGCGACTTCAATACCTCGACGCCAACCAT
TGGCGGAGACACCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCAAGCCATCGACTCCCGGAGTCGACGGTGTTACGTCACC
TTGGCTCTTATTATTGGCCAGACCTGATCCAATCAGATTCGCATCAGCCTCCACGGCTGAGGCGTGTGACTCGTCTGCGTCATCCGTGCCCCTTGAGGTC
GGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGATCCCCGAGATCAACACATTTTCTCCTTCAGCCGTCGGCGGCGACGCCGACGCTTGCTGCTCTT
GCGCGTGTGCTCGCGCGCGCCCAGGGTGTTCCGGGACAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGC
AACAGGGCCATCGCTCACTGTTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACCGGATCATGCCGTGAAAGCCATGGCATG
CCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACGATAAACGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCT
CGGTCTTCACGACGGCACCCGTTGTCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAAC
AAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACATTCAGGATGATAAGGTCATGCTTGTCATCTTGG
TTCTTACAGTGAGAATGAACCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGCGC
CTACTGGCGTCCAGCGTTTTTTGGTAGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAG
TGACCGATTCTACCGCATCGGTAGCATCGCACATTGTTTCCTTGCGACTGCTGGGGTCCAGCGGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGGCCTC
CGGTCCTCACTACCGGGCGTGGCTGTGGCGTCGGCACATGTGCATGCAGCTTAGCCTGCCACAGACTAAACTCCTCCTGCATTGCGAGAGTAATTGCAGC
TTCGAGAGTACTCGGGTACTCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACGTGACGACCTTGGTCGTCTCGTCGATCGGA
TTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGAACCTCCGCCCTCGACCGGA
ACTCGTTTTGCGGTGGCTCAAGCGCTTGTCTGAACTCTTCCTTGAAACCCTCGTACGTGCTGAAGCACGTAGGATCCGAGAGTCGGCGTCCATACGCCCA
ACTTCTTGCACGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGC
CAACGGAGGAGAGGTTCACCCTCTCTTCCGACATAGTTGCTCACATTGAGCTTCAGCGATTGCGCGCGTGGTGTCGTCCCGGACGACACCGCGGTAGTAG
CAGCAACATCGCGTTGCTCCTTCAGGATGAAACCCAGAGCAACACCGTGTTGCTCTGTCGGCGTTAGCGTACGCAGCATCGTAGCTACAGCCGCCTCACC
AATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGATCCGACAGGTGGGGACAGTCAGCGCGTACAACGTGAGTTGCAGGCGTAGTGGAGCTTTCC
ATGGGCACCTCTGTATCCATGGGAAGGTTCTCAGCTCCGTGTTCGTGCGGTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTAC
CAGGTGTAGTGGGCCTACTTTGGCTCACTACTTTAACTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACTC
GGGCCTCCGTGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCGA
AATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAACGATATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAAT
AGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTTTACACCAAGGT