Description :
From Genome Similarity Track
Location :
Scaffold_27:309444- 310855
Transcript NameFunction/comments
g6613.t1hypothetical protein

Sequence
1411 bases(100 bases per row)
GATGACGCCCACTTGCCAACTGCGCTTAGTACCGAGGGGTGATCAGTGCAAGCTGAGGAAAGCTCGCCTCGACATCTTACCGAATGTGAGTTTCCATGCC
ATTGTATGAACAACCTGTATCGCTTTTCGTCGAGAATAGACAACCGCGTAGGTGTACCCTCAAGTTGCAAGCCTCGATCACCACCAGTTCTAGTGCCCGC
CTGAGGACTCGAAAAGCAGTGTATCCATCCAATCCCATCGGACCAAGGCGGCTACTTTACTGTTTGAAAACGCCTACGGGGCGGACCTCAAGCAGTATTA
AGACGATGTAGTTGAAGCGAGCCGAGTGAGACTCAACCTCCACAAGCCACACGAAAAGTCTCGTAATCGGTAGCAGCAGCCTTCAAATCTGTACCACTAG
CCTCCTATCTCTGCCGTCCTTTTGCACCAGTCACTTTCCAGTCTCCATTCTGCTGTTGAGCTCCTCGCCAGGCACCATGAGGAGCGATGCAACCGCGGAG
GAAGTGGCGATGCTGCAGCGCCCGTTCGTGCGTGGCGAGACCGACCTCTTCGCGTACCTGACGGCGCTCATGAAGCAGCGCACGTTCATCTTCGACGGCG
GCATGGGAACCATGATCCAGACGCACAGGTTCACCGAGGAGGACTTTCGCGGCGAGCGGTTTGCCGACTCTCCGTGCCTCGTTAAGGGCAACAACGACCT
GCTGTCCATCACGCAGCCGCAGGTCATCAAGGACATCCACAAGCAGTACATGCAGGTCGGCCGCGCGCAGCTCATCGGCACCAACACCTTCTCAGGCACC
ACCATCGCCCAGGCCGACTACCAGATGGAGCATCTGGTCTACGAACTCAACTTTGAGTCGGCCAGACTGGCCCGGGAGGCGGCCGACGAGGTGACGCTGT
TGGACCCTTTGCTCCCACGCTTCGTGGCCGGGTCCATTGGCCCCACGAACAGAACGTTGTCCATCTCGCCCAATGTGGAGGACCCAGGCTTCCGCAACGT
GACGTTCGACGAGCTCGTAGACGCCTACTACACGCAAGTGGAAGGATTGGTCGACGGAGGCAGCGACGTGCTGCTGGTGGAAACCATCTTCGACACGCTC
AACGCAAAGGCGGCTGTGTTTGCCATTAACAAGTACCAGGAGACCACGGGCCGTAAACTGCCGCTGTTCATCTCTGGTACCATTGTGGACATGAGTGGAC
GCACGCTGTCGGGACAGACAACCGAAGCGTTTTACGTCAGTCTGCGCCACTCGAAGCCCTTCTGTATCGGCTTGAACTGCGCTCTGGGCGCCAACCAGAT
GAAACCTTTCTTGCAGCGCTTGGCTAATGTTGCAGAGTGCTTCGTGTCAGTGTACGCAAACGCCGGGCTACCGAACGCCATGGGGGGCTACGATGACACG
CCGGCCATGAT