Description :
From Genome Similarity Track
Location :
Scaffold_1373:3093- 7306
Transcript NameFunction/comments
Phypl_g13247hypothetical protein

Sequence
4213 bases(100 bases per row)
TTCGTCTCCTGCCTGCATAGCTCTGAACCGTGCTTGAGCTTTTGCGCCTTTGCTGAACTCGTGCATCAACGTTCCACAATTCAGCTGAGACATAGGAAGT
CACTCAGACTCTGATTAACCTTTCCATCTCACCAAGCACTCTCGGACCGGTCTCGAAGTCCGAGTACGTTTCACCCAGCGAATGTCACGGATAGCCTCCA
TCTCGTATACACTCTGAGCTTCATTGACCCCAGACAAACCTTTCGGCAAGAGAGCCGCATCCAGATCGTCTCCTTCAGCGACATCGATCTCAGCCGTAGG
GCGGTCTGAGAACAGAGCGCGCGGTATGAGTCGACTAATGTGGACCCAAGGGTACAACTTGTATCCGGATCCCTCAATTCTCAGCCTACACCAAAGATCA
TCTGAAGTCTCAATAATGCGAAATGGGGCATGCCACAGGTGGGCGAACTTCTTGGTTAGTCCAAGCTGGACTCGAGCCAGGTACAGCCATACGGTGTCCC
CGACTTCAAAGCCTTTCTTGAGCCTCTCAGTCAGCTCGAGCCAAATCTTGGTCTGGGCTTCTGAGCGTTTCAGCTTCGCCTTGGCTTGCAAGTCCTTTGC
CCAGGCTCGCGCATATTCGTACTGACGTTGAACCTTTCGGCGCCACTCGTATGCAGTCCGTTGACCCAGTCCTGAAGGCGGTGATCCGAGCATAGCCGAA
ACTGTGCTCTGAGGGTCCCAGCCATGGACCAGGTAGAACGGGGTGTCTAGACGAGTGGCATCAAAGGACGTATTCAGGGCCCACATCAGCTTCTCGACCT
GGTCGTCCCAGTCACTTTGGTCCGGCTCTGAGACGTAGGCTCGCACAGCTCGAACCACAGTCTGCACAGACCGTTCTTGTTGGCCATTGGCCTGAGGACG
ATATGCCAGCGTGGCCCGTTGCTGACTACCCAGCATCTCTCGGAACTTGGTGAAGACTTCATTCATGAAACGGGGGTCCCGGTCGTGGCAAAGTATGACA
CTTGCCCCAAACCGCTGAAACACGCATTCCATGTAGGCTTCGGCCACTTCCTGAGCTGTAGTGACGCTCATAGGTCGGCAAATTACGAACCCGCAGAACG
AACACTGGAACAACAACAGGAAGACGTCATCTCGATCAGACTTGGGCAGATGCGTCACGAAATCCACAGAGATCACCTCAAACGGCCGAGTTGCCAAAAT
GTTACCAGGTGACGGCCCAGGGTTGGGCGGCACTCCTTTTAGCCGTGACGCAATCCACGCATTCCTTGACGTAATGTTCCACGTCAGCATACATCCCCGG
CCAATAGTACTCTTGGCGTAAGCGCTCGAAAGTCCGAGTTACTCCTTGATGTCCGCCCTGAAAGTCCTCGTaactcagctgcagcaggtctcGTCTGAGT
GCAGTGGGAACCACTAGTCTCAGATTACCTGCCGCGTCTCGAGGCCGATTCGGGGTGGGCCGGCTCAGATAATACAACGCTCCGCGTGAGTCAAGCACAA
ACTGGTCTGCTACCTTAGCCAtctcttcagcttctgccGTCGACAACCTTCCCAGATCCCTTTTCAGATAGGCACTGAGCCGTCTCGTCCAGGgctcagc
gtcttgctgTGCCAGGATGCGTCGCCAACGCTCAGCCATAGGCGAGCTTGGTGTAGCAGATTCCGCTGAGAACGTCTCCTCCAAGGGGTCGTTCGGAGCT
CTTGCTGCGTCGTCCCTGGCCTCAGATGATTCCGCGTCTTGGCTgacaacaccagcagcttcctgaGTGCGGGCCTGATTTCGAGTGACCACGAAGATCT
TAGCTGCTGGGGCTTGAGGCTCCACCGCTGCCTCGATGGACACAGGCTCAGCTACAAGATTCCTCGGCTCAGAGTCTGGGATAGGGTCTGGATTTGGTCG
CTCAGatccagctccagccgaTTTCACCAACTTCTCCTGGATACGATTCAGTTGTCTGAGCTGAGTGAGTTCCAGCAAGTCCTCAACCGTCACAGCGGTC
CGAGCGTCCAACGTCTTGGTCGTGATGTAATCCGCCGCGGCATTGAATTCTCGCTTGACGTGAACTAACTTCAACGATCGAAACTTCCGACGAAGCGCCT
CAAactcgctcagcagcaactggagTCCGGGCTTCAGACACTGGATTAGACCTTGGGCCTGCTGAATAGCAATTCGAGAATCGTCTACTACCACTAGGTC
TGAGATCCCACGATCAAACGCCATTCGTGTTCCTTCGATCATGCCATGATACTCAGCTTCATTTACCGTAATGCCATCAAAGTGGAAATCACGAGCTTCA
ACTACCTCCCAGGACGGGAGCTTCCACAAGACACACCCAGAACTGCCTCGCCGATCTGAGAGCTTAGCTGCACCATCAAAGCTGAGCAACCAGCCCTCGT
AATCAGCCCCGAGCATCTCCAGACTTATCGGTGGAACCCGGACTACACGTCCCTTGGCTGGGATGAGATTCTCAGCAATCCTGTCCAACTGGTCTCGTGG
AGTGATCCCAGCTCCCATGATTGCAGCTAATCCATCCTCATCGGACTTGATTCGGTGAATTTCCAAAGGCCACGGGGCCAACCGAGCCGCCCACTGTTCA
CAGCGCCCTTCCAACGACCGAGACCGGAAGATCCACTTCAGCACCGAATACCGCGTGAAGACTTTCAGTAATTTCCCATCTGACAACATGGTGTAGAAGA
TGCGGAGAACTCGGAGCAAAGCGACAATTTCCTTCTCAGCCGGATGGTACCTGAACTCTTGATCATGGAGCACTCTCCCAGTATACCGAACTGGGCGGAT
GATTCCATCATATTCTTGGCCCAGCACAGCGCTGACAGCCCAGGGATTCGCGTGAACGATAATCACGAACGGCTTCTCCCTATCGGGGTGTCTGAGCAGT
GGGGTAGACACGATCTTCTGCTTCAAAATCTCAAACGCTGCCTTAGCTCGGCTCAGATCTCGGCCGGCTCGGATCTGCTCGTCTGTCAGCTCATAAAGTA
CCGAGGCCACAACCGGAAGGTCTTCAATAAACTTGTTGTAATAGTTCAGATTTCCCAGAAATGACTGGACTCCTTTCAGCGTCGACGGGAACGGGAGCTC
TCGTACATCCTTTGCGATTTTGGGTTTGGCTCTATCTCTTCAGTCCCAATTTCATGAGACAAGTAGGAAATCGTCTTCTTACCAAATTCACTCTTGGGCA
AACTCACCGAAATCCCCCAGTATCTCAGCCGATACAACAACCGATCCAAGTCGACACACATCTGTTCCCAGGTCTCAGCTCCATACGCAATATCGTCGAT
ATACGAACTTCGTCCCAGGACTGGGTTCAACACAGGCGGAGCCGGGAGGTTCCTTCGGAAGACGGTCATTTCCTCAGATAGTACTCGCATGTCGCTTTCC
TTATCTGAAGCTTCAACCTCAATTCCCAGAAACTCCAAAACGGCCGCTTCTACCTGAGCCTCTTCGCCGGGCGGGAGCCGAACGAAACCCCAAAGACAGT
TATCCAGCATATGCTGATAGATGAGCGGCGCGCTCTTCAGCCCAAATGGCATTCGCTTCCACTGGAAGTGACCTAACGAGCAAAGGAAAGCTGAGATGTG
CTTGGCTCTGAGAGCCATCGGCACTACCCAGAACCCACTCGCCATGTCCAAGCTGAGAAACCACATCGCATTCTCAAACCCAATCAACAGATCGTCAATC
AAAGGCAGAGGGTAATGCATGAGCTTGACCAGCTGGTTCACCAATCGGTAGTCAATACAGAGCCGAATGTCGACTcggttcttcttcatcacaATGACGA
TCGGTGACGCCCAACCTGAGGCTGAATACTCGATAAGCCCAGTCTCCAGCAGTTTCCTCAGCAACTCATACACCTTGTTGAGGTGGTGGGGCGGAATCTG
CCTAGACCTCTGGGCAATTGGTTGAGCGTCACCCACGTCCACGTCACAGACCACTCCTCGAGCTAGGGACGGCACTGCGTTCCCGCCACCGAGAAAGCTT
GAGTGATGCCTATCCAGGATCGCCCGGACTTGAGCATCCATCTCAGATGTCGAAACATTCGGCTCACCGACATTCGCAGTCGACAGATCCGCGCTTGGGC
TCAGATCTCGCAATTTCGGGAGAGCCGCTAGTTGATCTCGGAGATCGCTCAACAGCTCACCCCCTTCATGGAAGAATAAtgtcgcctcctcctccgcctc
gtcaATCTCAACT