Description :
From Genome Similarity Track
Location :
Scaffold_138:3093- 6891
Transcript NameFunction/comments
Physo_143390reverse transcriptase

Sequence
3798 bases(100 bases per row)
GGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGACGTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCG
GAGAAGGGCAGCGGTGGGCTGCTTGTGGTGTACGCGAGTGTACCGGGATACGATCATCCCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTG
CGCGCCGCCAGACTGTCGCACGCAATCGTGACAAGTACGCCGATGCGCTACGAGGCAGCAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTAC
GGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGAGCCGTTCTTGGTCCTAGATATGGACAAGTACGAC
TTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGACATCGGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTT
TGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGTGAGGGCCGCCAGGGCGCAGCAGCGTCTAATGAGTTCTTGGGGCCCGTCGAGACTGA
CGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCG
CAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTGGGTAACCAAGTTCCACGCGAGGTCACTCAGACCGTAACTGATGAGGAAGGCACTG
CAGGCGCTTCCGATGTGGGTAACATATTTCCACAGGAGGTCACTCAGACCATAACTGATGCGGGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGT
TCCACTCGGCGAGGTGGGTAACATAGTCCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGAACAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAG
GCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGGCGGCCACGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGT
GTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGG
GTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGG
CCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGAAGTCCTGGAGGAGTTCCA
GAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGTTCGAGGACGTGGTGTCCAAAGAT
CCACCGCCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGG
AGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCG
CAAACCGAACGAAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATTCCGCGCAAGGACGTGTTGCTC
AACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGAGGACGGATACTACCAGATCCTGATGCGCGAGAGCGACATCCCACTCACGGCTGTGA
GCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCGACC
TTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGA
CGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCA
GCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAA
CTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCACCATCAA
GATGCTTTTAACGGCATCAAAGCGAACTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACT
ACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCACAAGGCAGCCGAGCGGAACTATCC
AGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCG
TCCTTGCGGACTGCCGTCAACACGCCGCGTCTCTCACAGCGGATGGCGCGTTGGCAGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAAGCCGG
GCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCATCAGGCT
GGGGTACCGAGACGATGCCAGTCTCGGAGCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGACAACGTGCAAGG
CTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACG
ACATCCTGATGGAGGTGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTA
CAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCCGGTCCCAGCG
GGCTGCTGGAAGTCGATGAGTCTCGACTTCGTCTTCGGACTTCCGGCCGATGACGGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGA
TGGTCCACTTTGCTCCAGTTTGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACAGCACGGTCTGACCGAGACCAT
TGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCCCGGCACACGGCTGTCGATGTCGACGGCGGACCACCCGCAG
ACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAGGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGG
TTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTACGA