Description :
From Genome Similarity Track
Location :
Scaffold_93:30927- 32737
Transcript NameFunction/comments
Phyci_69161Hypothetical protein

Sequence
1810 bases(100 bases per row)
ACGCATTTGCATGAAAAGATTTTCGAGCGCACTTTCATCCGCCACTCCATGAGTACGCCCAGACTCCATTTGGTAAAAGAGCTGTGAACTTGCATCACCG
TCTTGCCACTGGCGATTTACCTCCAACGCTGCCATCCCCTCAAATGAACGTTGATCAGACTGGAAGAATGCATTGCTGTCATTCCAAGAAACGCCACCTT
CGTCTTCCAAACTGTCCACATCTCTTTCGACAGTCTTGCCCTCATCCTGCTGCTGTTGCTTCTTGTCAGTTACACCATGAACATAATTAACTGCGTACCA
TTCCACAGGGGTAAGTTCGTCTGTGTTGGCCAGCAAAAGATGTTCCTCTGCATCAAGGTCCACATTATGCACCACAAGTGGCATTTCCAGTTCGCTTGGT
CCCCCACAATACCTTTCATCCTTTTCAACCTGCTGAGCCACACTTGAAAGGGAAGCTATCGTCCCAGTAGTTGATAAGCCGTTTCCACCGCTGCTGGTAG
CAGTCGAAGACCACCAGCTGGGCTTTTCAATTGTCATACTCAGTACCATGTCAGAAGGTACTGCGAGGAGTTCATGTGGGTTCATCTCGCCGAAAACCTT
TTCAGTGAGCGAAGCTCCCACACGTAATAACGACGCTTCGATGGTATTTTCGCAGTGTAATCGATAGACAGGGAGCGTATCCGCGCCTCCCACCGCCATT
TTAGCCCAACTAGCACGCAGTTTTGCGTCACACGTAGCATTCCAATCACTATCCACGACAATGATCGCCTCACCGCCAAACACGGACGCAGCCCATTTAC
CATTGGACATGGATAACCGAGTAGAGACGAGGGCCACACGAACCACTGGGCGGTCCGCAAAATGACAAAGGGCGCGGCGTTGCATACCAACGGATCCGGT
CACGCGCACAAAACTAATATCGAGCAGAGACAGGAACAGTTCCAAAATGGGAAACATGGCGTTGAACTGGCAATATATCACCACCTTCTTGCCTTCCTGG
ACTGCCAGCCGTCGCAACAGTGGTTCCAATGACTCCAACTTTGCTGAACAGCTAGTCAACAATCTCAAATCTGCGTGCCCCAGCTTGTCCATGTCATTCA
CGATATCGACGCAGTTACAGATCTCGCGTAGGCGCAGTAACAGCTGCAACCAGACGCTTAGACGTTCTTCACGTCCACCGGAATTATCGAGAGTTGCCCC
AAATCCACTCAGAGCATTACGGTACTGCGTCTTTTGTGACGTACTTGGTTGGCAGCTCACACTGATCTCTTCGATTTTGCCTAGTTGCGGCTCCACCTCA
CTACGGACCCGCCGCAAGCTTAAGCAAGATAGAGCAAGGAACAATGCGCTCATGAACTGAGACGTGTCCTCCTGTTGAGAAGTGGCCTTCCACAACGACG
CACGTACACTGGACGATTTACCATATAACTGCATCACCTCCGCCACTGATGTTCGTTCCACCTGTAATTGTTGCACTGGCCACGCCTCCACTCGGTGCTG
GGTAGTTTCTGATCCATCGCTGGATGGAGCCTCGCGAACCAGAAACTCAGCATACTGCAGGCGTAGTGCAGTGTTTTTCCAATTCTCAATCGATTGACCG
TTGCTCAAGACCCGCCGTTGCTGTTGTCGAAGCTGCTGCAACGCGGTCACACACGATGGATCATCAAAATGCCCACCGTGTTCGTTCTCCACTACAACCA
TCTGCCAATGACTGAATTCCACAAAAGCTTCCCGGTCTTCTGCAAATGCATTCACAGGGCACAGCACGCAATACAGAGGCTCAGCACGCTCATCGTCGTC
CAAATTGTCG