Description :
From Genome Similarity Track
Location :
Scaffold_135:30922- 32912
Transcript NameFunction/comments
Albla_Nc14079630conserved hypothetical protein

Sequence
1990 bases(100 bases per row)
TGAATTATACGTGGCAATACATGTAGCATTATCCTTCACACCCAGCATAAATCTATGGTCGGAGGAATCCAGTGTAGTTTGTGTGCTTGTAGTGGCCACC
GCCATCCTTCCTTGGCGCAAAAAAACGTCAATAAGTAGAAAAATCAAAGGCCTTGGCTCCTTTTCCCTATTCTAAAGACTCACTTGTTACTTTGCCTCTT
TATTTTAAATTGGAGTCACGCACCAGATCATCTTTTATCCTCTTTGAAGTTTCTAGCATCTGAGAGAGAACCCCTTGGTCTTAGTCGCATATGGAGCTTA
CAAACGGTACCTGTACGATAGCGTCACGCTGAATAACATTCTCTCTTCCACCGATTTCAGGGAGGAATACAGCTTTGGAATGCTGCAATTGTGCAATGGA
GAGATATTCTTGAACAAGCCCATGCACAATTCGATTATGTAATGTGGATAGTCGATTCTTCGGAAGCAATTGTTCACTTTGATTGCTATTTCTACAGAGA
TTCTCCTTCTTTCTTTGCAATTTCTCAATACACGCTCGACGCAGCTGAGCCTTACATTTCAATAGTACTTCAGCTTTGAATATGTAGATTTCATATACTT
ACGCGCATAAGGTCCAGCATCCCATTATCACGAAAGGATTTGAACATTTCGATTCTAAATGTCTCAACACTCAGCATCTTTTCTTCTCGACCAGCTATCG
TGGAAGTTGGCATCGAGGTATGGCTCATCGCGTCGTTTCGTGGTGTGCGCTATGTGAATGCTTCACTGCAAGAAAAGATTATTTTCATTGAATTCTACGT
ATGAGCATTTGCATAGCGCGCACAAATGTTCAAAGTAATCAAATGAGTCAGTCACAATAGAGCTATAGAGAGCTTAGCTGAAGAAAATAGAACACGCGAA
GAAAAAGCATGCCTATCACAGAGTCGTGATGCGTTTTTTATAAAGTCGCAGACTTGAATTACGGTCTCATCTCTGATGAGCGTACGAGCTTTCTTCTTCT
TCATCATCGTCTTCGTACTCATGCTCGTACTGATACGTCTCGAAGGGAGGTGCTTCCGGTACAGCTACGACAAGTCCATCCATATCTTTCGTCAATATAA
TTTCTGTTCCGAGGCGAGAGCTAGAAAACTTATTAGCACGATACAAAGAATTTTCTGGTCTTGACTCACTTTGCGGAGCGATCTTCTTCTGGAACATAGA
CATCCAAAATATGTTGCTCTTGATCATTTGGTCTTGGTAGCCTTGGCATCCACTCATTTGATACGATAACATGAGAAGTCGGCGATACCGAGCCTGGACA
CGTTACGATTAGCTTTTCATCTGATAAAAATATGCGTGCCAACTCTACCTTCTCCAAAGAGCGATTCCGTGTAGTAATCTGAACGAACGGCACTGTGAAC
ATCTCCACCCCCGTTAGAATCATCTTTCAGAAGATCAATGTCATTCATTTGACAAGCTTGACATAATGTCTGTCCTACGCGCCCTTGGACATACTGACGA
TTTCCCGAGTAATCGATCAATGTGACGCCAACTCTATCTTAAATGGTTTTGTACGTTTCCGAGCATGTGTAGTCATAAACTTACACGATATCCGAAACCT
TGGAAGTGGATATGTCAGATGGTGGCTTGATGCCTCCAATAAAGCGGCGGTGTGAAGTGGGTATCACTATCCTGCGCGATAGAGTCTTGACACTTGTTAG
CATATCTTCCAAGCACGTATGGCCTCTTAGAGCTTATAACCGCTATAAGCTTCTCCCAATAGTGAATGAGGCTAAACTGCCAAAAACCTTAAGAAGTTGG
TCGCGGCGCTTGAAATGAATCGAGCCGAGAGGAGGATCGGGAGGTATCCCACTTTGAAAGTATACGCAGTAGTGGATAAGCGGTGCTTTCTTCTGGTAAG
AAGCAGCTCTATCAGACAAGGCTAGCTCGTACGAGAATTGAGCAAAATCTGCTCATCCACTCCAAAACATTATAAAAAGAAATGGAGGAA