Description :
From Genome Similarity Track
Location :
Scaffold_1108:3092- 5448
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1108-snap-gene-0.2Conserved gene of unknown function

Sequence
2356 bases(100 bases per row)
GTGGACGTGTTGGCTCATGCTGCTAACGATTGCCCCGAACGCCACAGTGAACGCCATCATGAACACTAGCACGTTTGACAACGGCGCGTTCTGGCGGCTC
ATCGATCCGCCTGCGTACATGCTGGGCATCGGTCTCTCCGGGTTGACTGTTGTGGCGCTCGCCTATTTGTATATCATTATCCGAGTGACCGTGTTTCGCC
ATCGCCAATTCGGCTCCAAAGGTGTCCGCAAGTCTCGTCGGGCGATCATCCACCGCTATTACAGCGCGTTCAAGCGCCGCTTGAGAACGTTAATCATTGA
GGTATCTCGGACCGAAAGCAATCGTTTCAGCTCCAAGTCAGCGAGCGATGTGGTGCGGCAAGCTGCTGTGGCGGTGCTGAGTTTGACTTCTGTGGAGAGC
TCTTCGAGAAAACTGGTTGTACGTAGAATGTCTGGTTGGAAAGACAAAACTCGAAGCTGAGTCTCCTACTGAACTGTGGTGTGTGGCTTGATGCGCAGAA
CGTGGTGGTAAAACTCGTGGATCTTGTTATCCAGTCGATCATGCTGGTTCAAATCATGGAGTATGGCATGCCGCTCGCGTTCGTGGCCGTGTTTACAGGG
GTGATCGTCTGCAACGCGCTGGCAACAGCCATTGTGCTCGAGTCCTCATTGTCTCGTCCTGCCTTGACCGTCATCCTCCTCGACACCATGTAAGAAAGAG
CTAACTTCATTGCTTCGTGCAACCTGCCAACAAACAATTGCGTTGCTCGTGTAGGTTCGATTTAACTATCGCCGTCATATTCCCAATCGCTGTTCTGCTT
CACTGCATCTCGGCGTTTTCATTTGATCGCAAGCGCCTCGCCATCAACGAAGCGATCTTCCCGCCAAGCTGGTTTGAGCGCGTCGCGAGCGTCGTTGCTG
ACCCTGTAGAGACCGAGATCATTCGGAACTCGCTCAACTCGCTGCGAATCTTCTCCCTCATGACCATGGCCACCCGTGTTGGGACAAACATCGCCGTCTG
TCGTCGCTTTTACCAATTGGCCGCTCTCATCACCGACCCATCTAAGCAATTCCGCGCTGTCTACCCCAAGAAACACTCGATCGGTGCCGTATTCGTCATG
ATTGCCATTTCCACCGTTATATACGCCGAGGAGAGCATCAGAACCTCCAACGTCGCATGCCACCCGCATGCACAGTGCGTTCGGTATGCTCGGCGGTGGG
TGTCACTACAGGAAGGCGATTTATCACAATGTCCATGCTTGACAATCATCGATGTTGACGTGGCGCTGAAGACATATGATCAATGGCTGAACCCTCCAAA
TGTGACCGAGAAGGTGGCACAACTCGCCACATCGGGCGATCTGCAGATGATTCGCCTGATCAACAGACAGCTCCCAATCTTCCCCGATGAATTGCGGCAC
TGCAAGAACATGAAGCATCTGTACGAACGGCGATTTGTCCATGAAGGCACGCGAACCGATCTAATTGTCTATATATGTGCGAAACAGGTCACTGATTTAT
AGCCACACCGAGACGATGCCAGTGTGGGCGAAGGAGTTCACCAACCTCGAATATCTGTACGATGTTGTTCAAGACATTATGTGTTTTAGCGATGCTGACA
CGACCTATGGTGGCAGGCACGTTGAGGGAAAGATGGGGATCAGCTCGCTCAAGTTCTTGCCACCCGACTTGTTCAATGACATGTCGTCGCTCACCTTCAT
CCACTTGGCGGCCCACGACCTGGTCACCTTGCCGTCATTCGACGGACTCGTCAATCTCAAGTCGCTCACGCTTGCCGTCTTCGTGTGGATGCAAGAACTG
CCGAGCTTTCAGCATCTGTTCAACCTCGAAAAACTACTGCTGACTGTTTTGGTAGCGGTAGATAGCATACCGGACATGGCAGCGATCAAGAACTTGAAGT
CGTTCATCACAGGCGATCGAGGTGTCTTTTGCTGCAACGGCTTCATCGGCAGCTGCAATCTAACCGACTCGTTGTGCGACACGCATCCAATCACCGGCTT
CCCGCCTGCAACATGCCTCCCCGAACACCGTACCGACAAGATCGCGACTTCAGCCACGCGCCGAATGTTCAAGAAGTTCTCGTCCAGCGTGTGCGCGGAT
ACGGCACTGCAGCCTGGGTCGTTGGAAGGATCGCCCACCGAGCAGTCAATGAAGAAATGCAACGGAACGATGTATCGGCGATGCGACGAGCCAGGGTATA
AGGAGGCGATGTGCTACAACGCTCGAATGATGGCGATCGCGTGCGACCCAAATCCGCTTCCGATCGCGATGCGCCGCCAGCAGATCGCGTCAGGTGTTGG
AGATCCGTGCAACATCGAGGAAGAGTCGTGGTTGGGTTGTACAGGTTCTTCACACA