Description :
From Genome Similarity Track
Location :
Scaffold_1:309186- 314772
Sequence
5586 bases(100 bases per row)
GAGTGGGAAGCCCTTCACCGCCTCGCGGCGGTGTCTGGTGAGGCTGTAATCGCATCGCTGCTGAGCTCAGCGACGTCCGACCAACAACGCCAAGCAGCCC
AAGAGTTCATGGTACGCGAGCTAGCCGATGCGAGTCGGCGAGCAACAACTCCCGCGCGCTCCTTGAAAAATAATGTCGTGAAGCTAGAGACGTCTACCTA
CTCCGGTGAAGGAGCGAATCGCCTCCCGCTGAACCGGTGGTTTCGCGAGATCGATATCGCGATTGCTTCGAGAATGATCGAATCGCAAGGGACAAAGGTC
AATTTCTTATTGTCCCGGTTGTCCGGGAAGGCCAAGGAATTGGGCCCTCGGTAAGCTTGTCGTTGATCACGACGCATTCCCCACTCTGGAGTCTCTCCAG
AAAAATCTCAGGCTCGCGTTCGAGCCGCCTCAAGACGAGTCCCGCGTGTGTGCCGAGTTCTTCGCCCTTCGTCAAGGTAAAATGACTATGCGCGACTACG
TTCAAAAGACTCGCCACCTCGCGTCATGCATCGTGACAAATCCGATTGACACAGCATCGCAGGTCCATGTATTCGTATTCGGCATGCGTGAGGGCATGGC
ACGGTACTGCCTGACCCGAGCGGAACCTTCCTCTCTCGAGGAAGCATTCGCCCTCGCATTACGCGAAGACTACGTTGTGGCGGCGTCTTACGCGCGCGCG
ATGTCTACGGCAGCTCGTGAGTCGACCCCCGAGCCCATGGAGATCGACGCAATTGACGCGTCGAATAGTCACCGTCAGTCGACTTCTCGTGGGCCCAACG
GCCATCCTAATCGCCCGTTCACTTGCTTCCGCTGCCGGAAGATCGGTCATCGCGCGGCGGAATGCCGCGCGCCAGCGCCGGTACTCGCGCACACCGCCGA
AGTCTCACCTGCCGTTCAGTCAAAAAACGGTCAGGGCCAGAAGGTGCGGGGCGCCCTGCTGGCTGGAATGGAGGTCCGGGTCCCCCGGTGGCTACCCAAC
CTTCTAGCCCTCCTGTGCTCCACGCACACTTTAATGCCACCACCACGTCGGGCGACTCGAGGCTGATCATCGTCAGTCTTCATGTCGCCGGCGCCCGGCA
ACCACTTCGCGCACTCCTGGACTCAGGAGCGTCGAATAACTTCTTTCGCGAATCGTGCTTATCAATGCTCCCAAGAGAGATCGCAGTCCGTAATGGTCGA
GGTCAGGTCGTCGTCAAACTTGCTGACGGAAAGCCACGCCGCGTTGCGCGGCGCGAGGTACGTTGCCGTACACATTCGACGGCTTCCGCAGCAACGACGA
CTTCCTCGTGATTGAGATGAACTACGCGTTCGACTGCATCTTGGGTATTCCGTGGTTGTCACGATATCAACCAGAGATTGACTGGTTGGCTCGGTCGGTT
AAACACTGCTCTGGCTGCGATGTGAGTGAAATGTTCACGCACCTCCTGGTTGCCCAGAAGGACTGGCCCCATGTCAGGGTCGTGGACCGGTTGTCCACAA
TGCAGGTTGAGTAGAGAGCGAGCAATGGCCCTCTCTGTATGTCTTGCACAGCGCTGTTGCGCGAAAACCCCTCGCTGCGAAGCGAGGTTGTTGACACTTT
GGCGGTAAAACAGGGGCTCCCGCAATCCGAGCAGGCGGTCGAGCATGGGTTTGCGCCACGTAACACGGCGGTCGAGCATGAGTTCCCGTCACGCAACACG
ACGGTCGAGCATGGGTTCCCGTCACGCAGCACGGCGGTCGAGCATGGGTTCCCGTCACGCAACACGGCGGTCGAGCATGGGTTCCCGTCACGCAACACGG
CGGTCGAGCATTGGTTCCCGCAACACACCAAGGCGGTTGAGCATGGGTTCCCGCAAAACACTGTAGCGGTTGAGCAGAGGTTCCCGCAACGCAATTCGGC
GGTCGAGCAGTTGGAGCTCCCGTCATCCACAGAGGTGGTCGAGCAGTTGACACCCCCACCGGCTACGACGGCGATCGAGCAGGGGCTCTCGCCAGTCGAT
GGCGCGGTCGAGCATCGAGAGCTCCCGCGCACTACCGACACGGTTGATGGTGCCCCTCCGTGTCTAGAGGGGGGGGGGTGATCCCTCGTTTAGCGATAGC
GAGTCTTCTGTCTCGAGCAGCGGTTCGAGACGCCACAAGAAGAAATCCAAGCGACGCTGTCTTAAGCGACGTGGTCAGCCCATCGCCGATATCGCAGTGA
ATGAGTCCATACACGTCCTGGAACACGTGGAAGGAGGCGCCGTTCGCTCACGCACACTTGACATTGAGAGCCCACCTCGCGAAGCTTCTTCCATCACACG
CCTTCCGGGTCTTTCCTGGAAGCATTTTCTGCGCGATCTGAAGTCAGGAGACATCGAGCAGGTCTGCTTGATCACCGTGTCTGCCTCGGCGGAAGAGATC
CACACGGTCGCTACCAACTATCTTCCACTTCGTCCAAAGAACGCTGAGCCGAAGTCGGCGCGCGAAGAGCGCTTCGCTGCCCAGTCGTGGTAGTCACTCC
GCGACTCGGGCATTCCAGTATACGACACCGTCCGCGAGTTCGCGGAAGTTTTTCCCGACAAGATTCCAGCTGAGCTCCCTGCTGACATAGGCATTCGCCA
TGAGATTGATCTCACGCCGGGTTCCAAGTACTGTGTGACGCGACAGTGGCCCCTCCCACGCGATCAGGTTAAAGCCATTGGCGACTTCTTCGAGAGCCGC
CGCAAAGCGGGTCACGTGCGCGAGAGTACCTCGCCACACTCGAGTCCGACGTTCTGCGTGAAGAAGGCCACGGGTGGTTGGCGCATTGTTCACGCTTTTA
ACAAGCTAAACGACGCCACCATCCCAGCACAAACTCCGATCCTTCGGAAGGATATGGTACTTGACACCATGGGCCGCAGTGTTATTTTCAGCGCCATCGA
CCTGACCGATGGCTTCTATCAGATCTTGATGCGACTCAGCGACATCCCGCTCACAGCGGTGAGCACTCCCAGCGGGATGCTGTGGGATTGGCTTGTCATG
CCGCAGGGCCTGAATAACGCACCAGCCACGCTCAATCGCATGGTTTCCCACGTTCTGCGCCCACTTCGCGACTTCGCTCCGAGCTACTTCGATGACATCT
TCGTTCACAGCCGCGCTAAGGGCGATCTCAGGGCCACAGAAGTTCGCTTGAATCACTTACGACAAATGTTCCAAGTCATGCGCGAAAACAAACTGAATGC
GAACTTGAAGAAGTGCATCTTCTGTGCCCTGGAGATTCCGGTGCTTGGCTGTTATGTGAGCACAAATGGTGTCCGAGCGGATCCTGAGAAGGTCTCGTCC
ATCTGTGCGTGGCCCACGCCGCAGAATCAGACTGAATTGCGTCAGTGGCTTGGCCTCGCAAATTATCTCCACAAATACACGAAAAATTACGCTGGTCTGA
TCCAGCCATTGTCTTCATTGCTGAAGAAAGACATCACGTGGTCGTGGACTCCCGAACATCTGTCAGCCTTTAATGCAGTGAAGAAAAGCTTGGCGGAGGC
CCCAATCATGGCGCTTCCAGATGACTCAAAGCCATTCCACGTTGTTTGCGACGCGAGCGACTTCGCCATCGGCTGTGCACTGATGCAGTTCGACGACGAA
GGTCGCGAACGCGTCGTGAGTTACCAATCCAGACAGATGAAGCCCGCTGAGAAGAATTATCCGGTCCACGACAAGGAACTCCTTGCGATGCGCTACGCAC
TGATCAAATCCAGAGTGTACTTACTCGGTGAGCAGACATTCGCGATCTACACAGATCACGCGTCGCTGCGAACAGCGACGAAGAGCCCTCATCTCTATCA
GCGCATGGCACGATGGCTGTCATTCTTCTCCGAGTACAACTTCGTCGTTCACTACAAGCCAGGCAAGAATAACATCTTTGCGGATGCCCTATCTCGGCGC
CCCGATTACGATCCACGCCGAGATTTGGGTCGTCAGTCACTTGAAGACGCGGACGACGACGAATTGGACTGCGCCACATGTGTGGCTGCAGGTGTGAACC
TGATGACGGCGGTATCTCCAATACTTCCCCTGCGGGAAGAGATCTCTGCCGCGTATCGAGATGACTTGATATATGCCGGTATCCTGGAACACCTTCGCAC
ACCAAGTGATGCCACGCTAAAGACACTGAGCCGTTCCACGCGCGACCAGATTCACAGATACCAACTTGACGGTGATCTGCTGATGTACAGTATCGATCGA
TTTGATGCTCCTCGCGTCGTTGTCCTCAACGACCCCGATCTACGCGCAAGAATTATACACGAATTCCATGACGCTCCAGTGGGTGGCCACTTGGGCCGTG
AGAAGACTTTCGCAGCGGTATCCCGCGACTTCTACTGGCCTCACCTATACAAGTGGGTGCGCAAGTGGGTCCGCTCCTGCGAAACTTGTCAACGCGTTAA
ACCGTCACCGTCATCGCAAGCTCTGCTGCGTTCTCTCCCTCTGGCGACAGAAGCGTGGCGCTCTGTGTCAATGGACTTCATATTCGATCTCCCACCCGAT
ACTGACGGTCGTACTGGTGTTCTGGTCTTCGTGTATCGCTTTACCAAGATGTGCCATCTCGTTCCGGTTCCGGACTCAATCACCGCGGCCGATACCGCGG
TGCACTTTGTCGACGCTGTCTTCCGACATCACGGCCTTCCTGAATCAATCGTCTCTGACCGCGATTCCCGATTCACATCGGCGTTCTGGACGAAACTCTT
CGACCTCCTGGGCACCAAACTCCTCATGTCGACGGCGGCGCATTCGGAGACTGACGGGCAAACGGAACGCGTCAACCGCGTGCTAGAAGATGTTCTGCGC
AGTCACGCCCCGTCCTTCGAGAACTGGAGCTCCTTCCTGCCTCTTGCGGAGTTTGCACTCACCAATGCCGAACACGCGTCGACGGGATCGACTCCATTCT
TCGTCAACAACGCGCGTCATCCACGTGTCCCCGCACAACTTGCTGTGGGCCAACCCACGGCGACTGATGGCTTCACTCTGGAGGGGGAGGAATGTGATAA
CCCTGCCCAACCGGTTCCGATACTGGTTCAACCACCGGTTTCCGGTGAGACAACGGTTCTGCCGTCTACGAGTTCAGCTACTCCTGCAGTAGACATCAAC
GCGGTGACGCGTTTACAGTTGAAGAAGATCCTCGCACCCGCGCAATCCACGTCGTCGCCGTTAGTTGACTGGACACACCGAACGCTGATCGCTCCAGCAC
AGCCACACTCGACTGTGGCTAACTACGCGCCGAAACCTCCAGCGCGACCCGCTGACAAGGCAGCGGTATCCGACTTTTGTCCTTCATCGCCAATCGGTTA
CCCGATTCGTCCGTGACGCGCTACAACTCGCTGTTGACAAGCAGAAGGAAAACGCTGACAAACGTGGCCGCAAGAACACAAGTGCATTCAAGATTGGTGA
GCGTGTATTACTCTCAACGGATGGAATTCGTACCTCTGCTATTACGAACCTAGGCGCGAGCAAACTCGCGCCGCGCTACATTGGGCCATTCAAAGTACTA
CGAGTTATGGGTGATGCCTACACGCTAGACATTCCTACGACGCTACGACTACACCCGACGTTCTACGTCGGGTGACTTAAGAAGTA