Description :
From Genome Similarity Track
Location :
Scaffold_481:3090- 4092
Transcript NameFunction/comments
g15962.t1hypothetical protein
g15963.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
GTCGGGTCCGGTGCCGCTTGCCACCACGCGCCCTCTATCTTAACAGGAGGCTTCCTTCCTCCATCATGCCGAGCCATTGCCAATGCCATTGCCATCAAGC
TGCTGCAGCTGCAAATATAGTGTAGCCATGTGTCCGTTCTTCCACTTAATAGGGAGCGAACCCAGTTGTGACTCGAAGTGTTTTTCTTGGTGACCACAAA
GATTGTTACTCTCCTCCTTCAAAATGAGCTCGACAGTCAAGCGCGACCGGGAGTGGGAAGCGTCGGCTTCGGACGGCGCCAGTGCGGCCCCAGATGCCGA
CGCGGACGTGAAGCGACCCCGCATCTCTTCTCCACCGTCTTATCTTCCATCTGATGCGAGTTGTGCCCATCAACGCCCCGTATTGACGTCAGGGCAGCTC
GACGAAGCGCACCCGATGGCTGTTCTGGACGCGATCCGCGCCAAGCTGCAGAGCACCTCGGACCCCCATTTACAGGCCCGTCTTTTGTTACAGTACAGCG
CAGCCGCAGCCTCTCCAGGGGCCAAGACGGCGGCGGCCATCGACTTCCTCTTCTCGTTCCTGCAGCAGAATCAGACACAGTCGGAGACGCAGACGGACGG
GAATCAGAAGGACGCCGGCAGCAGCGGAGCCATCGTCGTGGGCGCCATTGTGCGTGGACTGAGGCAGTTATTGGCAGTTAAGGCGGCGGTGGTGGAGCCG
ATGATCCAAGTGGATGCCATGGGCGAGCAGCTCATGCAGTGCATGAGCGTGGGCGAGGACTTTAAGCTCAGGAGGGACATGATGCGCATCGTCGTGGACT
GCCTCATGCTCACCAACAAGTACAAACAGGTGGAGACGCTGCTGCACACTTGCGTGCAGGACCACGACGCCGGCATGCAGGCCATTTGTCTGCGTGCATA
TCTCAGACTGCACAATGCAGGGCGCTGCTTTGCTGCCGAGTCGTCGTCGATGGAGGAGGCTCAGGATACTGCAGCGAGCCATTTTGACCGCTTGGCGGCG
TT