Description :
From Genome Similarity Track
Location :
scaffold_534:309- 1349
Sequence
1040 bases(100 bases per row)
GTTGCCATCTGACAGAGTCATTCGTCATGACATTGACATACTTTCAGGTACGAAGTATTGCATTACACGGCAGTGGCCGTTGCAATTCATCCTCAAGAGT
GAAGAAAGTACACAGGTAAGTGGCGCATTGTTTGTGCTTGCGACAAATCGAATGACGCGGCCATACCTGCCCAAACTCCGGTTCCACGCAAGGATATATT
CCTTGATGGAATGGGTGGCAGTACTTTTTTTAGTGCGATCGATCTAAAAGATAATTTGGATACGAATTCGCAAATGGATACACCATTACTTCCAGTCAGT
ACTCCCcagtggtatgctgtggAAATGTTACGTGATACCGCAGGGTCTGAAGACGCTCCCGCGACTTTCAACGCAATAGTAACGAATCTTTTTATCCATT
GAAAGAGGTCACACCGAGTTGCTTTGATGATACATTTGTTcagtttaagagcacgggtGAGAAGTGTGATGttgatgttcatcttgatcatccTTGTCAG
ATCTTTCAAGTTATGCGAGAGAATAAACTCTACGCTAATCTGAACAACTCTATTTTCTTTGCACCAGAGATCCCCGTTCTCGGCTGCTTTGTGGGCAAGA
ACGGCGTTTGTGTAAATCCGAAGATAGTCAAGGCTATCAATAATTGGCCTATGTCAAACATAGCTGAGACAATGGTTGGGCTTGGCCATCTATTCGCACA
AATTCACGCACACATATGCAGCGTAGGGGCAACCCTAACGATTATTTAATGGCGAACGCTGAGTGGAAGGGGTCAAAAGATCACCAGGCGGTATTCGCCG
TAGTGAAGAAGAACGTGAGAGAAGCTCCTATTTTTGCAATTGCAAGCCACGATAAGCCGTTCATGTGGTCTGTGATGAGAGTGATTATGCCACCGGTTGG
ACGTTGATGCAAAACGATGATGTGGGTCGAAAGGAGCTGTTCTGTATCAGCCACGACAACTCCGGCCCGCGAATCGAAACTGTCCGGTTTATGAAAAAGA
GCTTTTATCAATGAGGCATGTTTTGATTAAGTTCGTGTAT