Description :
From Genome Similarity Track
Location :
Scaffold_10:30897- 46087
Transcript NameFunction/comments
Physo_108442predicted protein
Physo_112750kinesin 1
Physo_130052hypothetical protein
Physo_155984PREDICTED: similar to serine/arginine repetitive matrix 1
Physo_130054oxidoreductase, 2OG-Fe (ISS)
Physo_130055zinc finger (C3HC4-type RING finger) family protein
Physo_108443Protein kinase domain containing protein

Sequence
15190 bases(100 bases per row)
ATGACATGAACACACCGCGTTATGTAGTCGATTCATTTTTTGCTTTCCATTCGTTCGTGTTTTTCCCCTGTGGCAAAGTGGCGTCCGGCCCGTCCGCTTT
CCCTACAGAAAACTCAACTCTGCTTATGTCTTTTCAGCCTCTATGCCTCAGCCTCCCTCCTTGACAACGTTGGGATGTAGGGGCGACACGACCCGCTTAG
TATCGCAGCCAGTACGAGCGACGACGGATGAAGTTGTAGTCCGGCAGCTCGTGGATAGGGCCAGTGGCAGCCAGAGCGTGCTCCTTGTCGTTGATGACCT
CGTCAGCCGTCTTGCGAACAGCGGCGGCGTCCACGGCGTCGATGCGCGCGAAGATCTCGGCGGGGGTCATGCGGCGGCCGTACGTCAGCATCTGGCGACC
GATGTCCTCGCAGATCGGCGACGAGCCGTCCAGCTGCATCAGCATGTTGGCCTTCAGCTGCGTCTTGGCGCGCTCAACCTCCTCGTCAGTGGTCTTGTGC
ACAAGGCGCACCAGCGCCTCCATAGTGTACCACGTCAGGTCGTTGAGCTTGTACTTGTCCGCCACAGCGTACACGCCGAACAGACCCGTGTCCTGGTAGC
ACGTGTTGAACGACATGTACGAGTGCGCGAGCTCCTTCTCAGCAATCACCTGGCCCAGCTTCGAAGACATGTTCATGCCGGCGCCCGAGGTGCGGTCCCA
GCTGCCGAGCAGCGTCTGCATGATGAGCAGAGGGAACGAGTGCTCGCTGGTCCAGCTGAAGCCCTCGAAGGCAATAGCAAGGTGGGCCAGAGGCATGCTG
TCGTCCTTGACACGCACGTCCGAGCCGACGAAGCGCACGGGCTCGAGCGTGGGGGCCACAGCGGGGGTCGTGGGCAGGTCGCCGAACGATTTCTGGGCCA
GCTCCACCAGCTGCGAGTGGTCCACGGCACCGGCACCGGCAATCACCATGCGCGGGGCAGTGTAGTGCGTGGCGATGTAGTCCTGCAGGTCCGACTTCTT
GAGGTTGCGGATCTGAAGTAGCAACAACAGCAACAGTCAGTCAGTGGATCGGTCAATCAGGACTCGCTCTCAAGCACCTCTGCCCGCTAATCTTTCTGCA
CCACGTACGTTCTCAATGGGGCCGAGGATGGTGCGGCCGAGGCCGTTGCCCATGAAGGCGGTCTCGTGCAGGCGGTCGAAGACGACCTCCTCCTGCTGCT
TGTTGACCTCCTCCATCTCGCGGAGAATTACGTCGCGCTCGCGCTCGATGGCGGCTTCGTCCAGCTTGGAGTTCTGCAGGATGTCGCTGAGGATGTCCAT
GGCGCGGGGCACGTCCTTCTTGAAAACCTTGGCGTAGTACACCGTCTGCTCGCGGCTCGTGTAGGCGTTGAGGTGGCCGCCCATGTTCTCGATCTCGAGC
TCCAGCTGCTGCTGCGTGCGCTTGCTCGTGCCCTTGAAGGCCATGTGCTCCAGGAAGTGGGCAGCGCCGTTGTTCTGCGTGGTCTCGTATCGCGAGCCGG
CGCCGATCCACACGCCGACGGTGGCCGTCTCGCCGTGCGAGCCCTCCGAGGCCACGCGCAGGCCGCTGGGCAGCGTCGTCACCTCCGTGGCGGGCGCGTT
CAGCACGTACGATGGGTAGTTGGACACGGCCGCCGCCACCGACGACTGCGCGCGGGTGAGCGGCTGGCGCACGAGGCTCAGCTTGGACATCATCTTGCCG
ACTTCTGGGGGGCGGGCGGGCTACGGTTTGTTTGCTTCGCTTCCAGGCTACGAATGGGGAGACCACCAGTATGCGCTGGAGACCTCACGTTTGGAAGACC
GAATTTCCGAATTTTGAGATAGAATTCATAAAAACGCGAAGTCCCCCCCCTTGTGCTCTCAACCCTCCAACGCGCAGCATACTAAAACCAGGCTGCGGAG
TTGGGGTTGGCGATGTGTGATGGGTAGCGTTTGGCTGGTTTTCTAATCTGCGCTCAGCAGGCCGAGGCAAAGACAGAAAATGCTGGCGAAAGCTGCTGCT
TCTGGTGGTGTTGCTACTCAAGTCTTGCTTGAGTCAAGATGTCATTCTCGGTGGAGGCATGACCTTACCCAATGTTGAAAAGCGACGTTATGTACGCTAG
CAACTTCCATTTTAACTTAACCAAGCTAACCTTGCGAAAATCATCGCAAAATATGGCAATACGGCAATTAACCGTGCAGGGAACAAGTGACATGTTCTCC
ACTTGCTGCTACCGACCACGAGGAAACTTCCGGTTGAACGAAATTGGAATGCATTAGAGTACATGCGGCTCGCCTACATGTAACTAGCTCAGTGCAAGAA
CATCTCATTTAGTTGGATAGAACCGCACTGCCGGGCGCCGAGTGTACAATGTAGAAGGTGTTGTGCGAAGTAAAACGAAGTACCCGGGGGTTCGTGCTCG
AGTTCAGCATTGTAACGCTGCGAGAAATAGCAGAAGGCATTTCTTTGACTACGACGCAGATACTTATAGGCAGATAAGTTATGGGAACTTCGAGCGACGG
CGACTCGACCCTAGGGTCCCAGGAGCCGGCCCACTGGTAAGCAGACTGGAATCTCTAGGCTGTCTCCACCGCGAGAGCTATAGAAAAATGATGACCAGGT
GGTCCTGGTCGAGTGCCAGGCACCACTAATAATGTAGTCACCGCCTAACAGACTCTTGCCGCAAGCATGACGGTAAAAGCTGCAACCTGTATGCCAATCA
GCAGTCGCGACTAGCGAGTATCAGGTCGGAATCAGGCGACATCAACTTTGGATTCATTTCAATTCAATTCGTAATTTCCCGACCATGGGGTCGACCGCAG
ACTCCCGCGCGGGCATCCGCGTGTGCGCGCGCTTCCGGCCGCAAAACAAGCTGGAGCAGACGCACCAGGCCGTGGAGTGCGTGCGCCTGCAGGACGGCAC
CGCCGCGCACGTGCACAGCGAGGCCCGCGGCGTGTCGGACGACCACACTTTCACGTTTGACCAGGTCTTCGGCACTTCGTCCTCACAACTGGAAGTGTAC
GAGGCGACCGCCAAACCGCTGGTGGAGTCCGCTCTACGCGGCTACAACTGCACATGCTTCGTATACGGCCAGACGGGCTCGGGCAAGACCTTCTCGATGG
AGGGCGTGCCCGGGGACGCCGACTTTGAGGGTATCATCCCGCGCGTCATGGCCGACATCTTCGACGGCATCCAGAACATGCAGGCAGACCTCGAGTTCAT
TGTGCGGGTTTCGTACATTGAGATCTACATGGAGAAAATCCGCGACCTGCTGAAGCCAACGTCGACAAACTTAAACGTCCGCGAGAGTCGCGAGCGAGGT
GTGTGGATCGCGGGCGCGACGGAGGTTTGCTGTGCCTCAGTGGAGGAAATGCAGGAGGTCATGCGTTTGGGGGGAGCCAACCGAGTTATTTCGTCTACGA
GGATGAACAATGAATCCAGTCGTAGTCACTCTGTATTCATCATCACTATTGAGCAACGGAACATGGCGACTGGGTCGATGAAGAGTGGAAAGCTGTTCCT
GGTGGATTTAGCTGGATCGGAGAAGGTTGGAAAGACCCACGCCAAAGGTCAAACGCTGAAGGAGGCACAGCACATCAACAAATCGCTGAGCGCGCTGGGG
AGTGTAATGAATGCCTTGACTAGTGGTCATTCTGGCATGCACATCCCGTACCGCGACTCCAAACTCACTCGGCTGCTGCAAGACTCACTAGGAGGAAACT
CCGAGACGACTCTCCTCGTCTGTGCTAGCTCGAGTAGCTATAACAGCGAGGAGACAATATCCACTTTGCGGTTTGGCACTCGCGCGAAGAACATCAAGAA
TAAGCCGAAGGTGAACGAAGAACGAACCGTGGCAGAGTACAAGATCCTTGTCGCTGAAAAGGACAGGCGCATAGCTTCGTTGGAGGCTTTACTTCGCGAG
GCTAAGCGCGACGCCATTGAACCAGCAGAGTCTACAGTGGAAGAGCAACTGAAAGTTTTCGCGGCCAAAGTGGAGGAGCTTGAAGACGACCAGGCTTCCA
AGGCAGCTGAATTATCCAGTCTGGAGGACAGGTGTGCTGAACTCGAAACCCAGAACAAACAGCTCCTGGAAAAAGAGCAAGAAGTTGCTTCGATCGTGAG
CCGAAATGAAGACTTCTCGAAAAAGGTGACGTTTTTGGAAAGCGAATTGGAGGCCAAGGCAAAAGAATGTGAAGACCTCAGCCTGATGTTAGCAAGACGC
CGAACTACGGTCGAGGCGCCGCCATTATCGAGTGATAGCATGTCCTCGGAGTTGGCTTCAATCGAGGGAGGCGAAGCATCATCTGTGCCCATATCGCCGG
AACGATCACGCGCATGTAGCTCAGCAATGGAAAATGAACTTCTTCGGCAGCAGCTGGCGGCGAAGACAAACGAGCTCAAAATTTGCACGCAGCGTGTTGA
TGAACTCACAAAAGAGTTGACACGTTCTCGCAGTGAATACGACTCCCAGGTTGAGCTGTTGCAACACAAGCTCCGTGAATTCGATGCCCATCTGCAAGGT
CTTGGAAATCCAGCCGCACCGATGGATGCGGTGGGTGCGAAAACCAAGATGCTACGCTCCGTTCGTGGTGGAAGCCGAACCTCTCTCCTGGGTAGACGGT
CAATTTCGCAAGACACAACAAGACTTTCCAGCGTTAGTTCCATCCATCGCCAAGACAGCACGGGGTCAGCGAGTTCGCAAAGTGAGTGGAAGTTGGATGA
TGAAGTGTTCCCAGTTGCACCGATCGATATGGATTCGGAGGTTGTGCAGCGACTAATTCGCAGCATGCCTGAGAAGGGCCGAGAGAAGATTTCGAAATGG
TTGGGTTTCGTGCTCGAAGGACGTGACATCCGATCCAATTTCCACCCTGAGGTTTCAATTGAAAGTCTCAACGAAGAAGTGAACCGCGATATACGGCGGT
TGATTGTTCCGCTGCTGAAGAACCGCCGTGATCTTAACGTCCAGCTGTATGTCCGCACACGATACGTTCCCGTGTCGGACCTGAAGATCACGCTTGATCA
TAAACACAAGGATGAAATGCGTCTTGAAGCCTCGAGTGACAACGGAACTAGTGAAGGCACTTCTGCATCTCCCAGTTCATCGCTGTTGTGGGCGAAAGAT
CATCTCTTCTACGGGCCAAAGAGCGACGCTTCCAGTCCGTCGGTGCTTCATGCAAGCCGAAAACTCGCTCCGTCGAAAGACCGGTTCATATCGGAACCGA
TCGACCTCGGTGCCAGTATGACCGGGTCCAGATCGATGTTGCCGTCATCCCGTACCGCCCAGAAGTTGAGTCGAAAGGCCTCACTTCCGTTTGATTCATT
TCATGCTTCGGGATCCGGTCCTGGTAGCGGGGGAGTATTTAGCCGAAGACTGAAGACTGGAATGGGTGCAGTGCTTGGCGACGTGAAGACCAAGCTTAAT
GCTCGATACCACAAGAACCATGTTCACGAAGATGCTCTCTGCAATGGCTGTGGAATAAGCCCCATCGTTGGAGCAAAGTGGAGCTGTAGCACCTGCGTGA
ACTATGAGCTGTGCACCAGTTGCTACTCTGCTGGCACTCATGGGTTTGAGGTCAACAACGAGATGTGTCGACGAGTTGAACAACTCGCGGTTCAGAAGCA
CCGCTTGCTCGGAGAGTATCCCGAGCTGTTTGAACTATTTCGCCGTCACGTTTGCAACGATAACGTGATCCAATTTCGGCGAATTGTGGAGTGGCTGAGC
GCTATTGTATCTGGACGAGCACGCTCGGGCGAGATTTACCATAAGATGATCGTGAAAAGCGGTTTGCACCCGGACATTCGAGCCCGACTAGTAGCTCAGC
TCGGGGCGCTAGCTAGCCAACGCACCGACATCTCGTTGAAGACAGAATGGTTTACGGAGAGCACAGCAGATGAAGACTCCGATGGCAGTCAAGAGTCCGA
ACCAACGGAGCCCGCGCCCGCCGAGCTAGCTGGGGACATGCTGTCGACCTTTAGCCCGCCGGACGTTAAATTGGAGACGCTGCGAATGTATGTAATGGAC
GCGTCCAACTCGAAGCAAGGCAGCGAGCCGGTAGCAACAGCAGCGCTATCGGACCTGCTGGACCCGACGGCAACCGACCCGCCATCATTGAGGCGAACTG
TGAGCGAAGCGTCCGCGAACAGCGATCATGACGAAGTGCGACAGCTACCAGACATGCAGCGCAAGCGGTCTCTGGATCTGCCCACGTACGGCCGCCAGCA
GGTCAAGTCGATCACCCGCCTGAACCTGTGAGCGCCTTAACTGTAATACATGTTGTGGCGTTCGTCTACCTACCTAGGTACTTACTTGGCCACTCCCTGC
AGCGGAGACAATTGGCGCTTTGGACCTCAGCGGCAGTGGAGATGCTCAAATGCGCGAAGAAATGCGTACAAATGTGACGTGGCAACGCCTCCTCTCATGT
TTGGCTGTACCACCAAGATACAGCTCATGGGCGGCCGCGCCGGAGTCCCGAGGAGCGCCAAGCGCGCCGGCAAGGCTGGAGGAAGCTGTCACTATGTGAC
TCATTCGAGCAAGGCAAAGTCTGCTTGGTGGCGTGCTTCAAATCGTGCTCTCGAATCCTCACGTCTGGATCAGGTCCGAGTTCTTTCGCTTCGACTCACG
AATGCGAAAACAAAGCATGGTGCTGCCCAGGTACATGCCCGGCAAGGTCTGGCCGCCCTCGCCAAAATGGGGCTCGCGCAAACGCGCGTCTGCGCCCTGC
AAGTCTACAGCTACAGCTTTGGCAACAAGCTACGGTATCCTCCATGAAACGAGAAAGAAACTGATACATTAACCGGCACGCTGCCTTCCTAGCTCGCATC
CCGTTTTATTCCTCCGAGATGCTGAGCGAATGGCGACGATAGAGAGGTCAAGAGGACGACGCTTGCTGCCAAGCAGCGATTAAACCTTCTCGATGGCAGA
CGGTCGGCGGGTTGGATACGCAATGCGCCTAGGGGCAGGCCTTGCTGCACTCGGCCACGAACTCGCGCTGCTGCGTGGACAGGCCCCACACGGGCGCGCC
CCGGATGAGCAACCGCTGGATGAGCGTCTCCTCCTCGCTGGCGATCCGCGCGAGCGCCTGCTTCTGCTCCTCGGCGGCGAGCGAGGCCTTCTGCGCCTCC
CACTGCTGCATGAGCTGCTGCAGCTTGGTCAGGTCCTGGGGCTCGGCGCGCGCGCCCGGGCTGAACTTGGAGGTGGCCTCGGAGCGCGTCTTGGCCGAGC
CGTAGAAGCCGCCCTGGCCCTCCGAGGGCTGGCCGCCCGAGTACGTGGTCAGCGCGCGCGCGGAGCGAACGCGGCCCGAGGCGGCGGCGGCGCGGCGGCA
GGTCTTGAGCACGGCGGACTGCATGGTGGCTTGGGACGGAGTGGGGGCTTGATACGCAGCTTCTGCACGGACGCGGTCGAAAGCGGAAATGCGCTGGCGC
GGGTGGTGTTGCCGCTGCAACAAGATTCACGGAGCCGGATGGGAGCCGGATGGGGTTTCCATGTACGCTCGCTCGCACCAGAATTTGGCTGGAAAACACC
ACCAGACTCGGAACCTGACCTGGAATATCATGTACCTTAAGAACAGATATCTGCACAAGACGGTAACTGTTTTTACGACCTCTGTATTTGAATAATGTGG
TAGTATTTTGCGAAAGACATGTTGTGCACACTAGGAGCATTTCCGATACTATGTGCTATTTTGGCCGGGACGTGGACCAATCACAGGCGAGTGACGCGTC
CCTTTGGCGATGCGCAGGCTTGTCTCACGCACACTGGGCCCAAATGGGCAGGAAAAGGGCCGCCAAAAAGGGTGCAAAAGCCGGCTAATTTTGCTGGGCC
AAGGCATCTACCGTGGAATCTTTACTAGACGGATGAAGCTTTAACGCTCCGTAAGAATGCATGACAGAACATCACCTATTTTAGAAGAAAGCGCATATTT
CCCAGCAATTTTGTTTTCTTAGATACTGTCTGACAAGGCTACGTGACAAGCATCTTTTTTTATATTGCTTGGGTAATTGTCACGTGGCCTTGTCGAACAG
TATCTAATTTATCTTGCGCCAGCGAGTTCGGTAGTACCTGGCGCTGGTTTGTGAGTCTTACTCCTTTTTCATAGCAAGTTTTCAAGATAGTTTTAAAAGT
AAGCGCCGGCGAATGGTCCGAACTGCTTTTCTCTTGGCGAGTAGCCGCGGGTTGGACCGACAGCGTACAGAGCCACTTCTGGCACGGTCAGCCGCTTTTT
GTATCGTGGCGTTGCACGACTTCAACATAAGATTTTCTGCTTGGAAAATGGGTCCCTTTTACCCATTTCGCCTCAACGCGCCCAAAACGAAAACGCGGGC
CGCTTGAAGTTGTCAGATGCCTCCGCCGACGCAGGCCGCGCCGAGCTGCGAGGCGCCGCGTTGGTCGCTGTCGAGCCACGTGGTGGCGCTCGTCGCCGCC
GTGGGCGTGGCGCTGCTCGCGACCGCCTGGACGTCGCCCGACTGGCTGCCGCCCGACCGCGGCGTCTCGACGTCGACGGAATCCGCCCAGCCGCTGACTG
CGCTATCCAAGGACGACCCGCTCGTGGACAAGTACGAGAGCGATGTGGTGAAGATCGCCACGCACCCACCGCTCGCCGCTGCTGCTGCAGGTTGGACTTG
CGCCGATTTCCTGCCTGCGGACGAGGGGTTGACGCACATGGAGCAGGTGCTGGGCCAGGAGCAGCAGCTTCGAGCTCAGGGCCGAGTCTTCCTCATGCTG
AACGGGGAGAACGACGGGGTCTACGTGCCATGGACACACCTCCAGGATGGGGAGGCGTGCCTCTTTGAGCTCGCTCAGACGGCGGTGCTGCATCTAGGAG
CCGACGCTGACCGCGTGGCCAACGGGCTGAGCCTCTTCTCCGTCGACGGCCTGCCGATCTTAACGGCAAACGAGCTGGATAGACAGCGCGTTGCGCATGT
GCTCCTGGATGGACAGCTATGGGTCTGGCCTGGAATCAAGGTGGGCTACGTGCGCGAGATCGAGGGGTGCACTGTCACGACCCAGTCGCTGCGCCCGAAG
GTGTTCACGGTCGAAGGCTTCTTCACACAGGAGGAAGCGGACGCCATCATCGCCGAGGGCATCGATCATCTTTCGCGCTCTCCAGTCGACAGTGTCGACG
CAGAAGATGGCTACCACTCAGACCGAACAAGCTTCACGGCGTTCCTGGACGACAGCCACTTCACGCGAGACTTCCGCGAGCGATCAGCGCGGATCGCCCG
CCTCCCGTCTCCTGGCTATACAGAGAGGCTGCAGCTTGTGAGGTACGAAACAGGTCAGTTCTTCCGCAAGCACGAGGACTATTTTGACTCGAAAGAGTTT
GTACCAAGCAAGCACTTGGCTGCTGGCGAGTTCGTGGAATGGACTCATTGGGCCTCGTCCAAAATCGAGGAGCTCCGCCAGGAGCATGGCGACGATGTCG
TCCCAGTTGAGTTCCTACCTGGTGGTGCAATGTTCCCGCATGCCAAGAGTACAGCGGTATTTCAGCAAGCGCTGCTGAGAGGTTTCATGGAAGACGCTCA
AGCGACCGACTTCTTCTGGGAGCACGCAGACATGGCGTGGGGGGATTGGATTGACGAGAATCTTGAACGTGGAGCAGACGACATCATGGGCCCAATTTTG
GAGAGCAAGGGCTACATGCTGCCGTTCATCGTTGCGTCGTGGGAGAAGCGTGTGGGGCTTGCTGCTTTGGTGTACTCTTTCCCAAAGTTGCTTGTTAGTG
GCGTCACGCATTACTTTCGATGGATACGCTGGGCGAAGGAACGTGTGCAGACGCTGATGGACACAGATATCGAAGCTGTTCCGAAGAGTGTGAGACCTGA
AGGGCAAGACTATCCGACGTTTTACATGAGTTTCCAGAACCGCATGGCCAACTACCTGCTCGAAGACTACAGTCAAGAGCAACTTGTCGAGGCGCTTTCC
AACGAGTTGTATACGTGGCTTGTGGAAAACAAAGACAATAAAGACGTTTTGCTTGAGGTTCTGCGCCAAAGCTCCCGTGGATTCGACCTAGTTCTGGAGG
CTTGGACCAAGCGAGCTGGCGGCCAATTTGCCTACGAGAAGCCCAAGCACTTGCACCACTTCGAGCCGAATCGGTTCGCAACACTTTTCTTGTACTTGAA
CGACTGCCCCGAAGGTGGCGAGACAGTATTCCCGTATTCGAAAGAGCGTCTGGTGACTGGGATCGAGCGTGAAGGGATGGACGAGTGCTCCGAGGGGCTC
GCAGTGCCGCCCGTGAAGCTCACGGCGTCGTTGTTCTACTCGCAGACGCCGATGAACGACCTGGATCCGAGTAGTCTTCACGGCGGCTGTCCTCCGGCGA
AGGGCATCAAATGTACGTTGCCACGCCCTGTGCTTAATTTCGTGCACTCACCTTTTACTAACGTTAAATACCAATTGTCGTACCTCTGTAGATGGAGCCA
ATTCGTTCATGTGGAATGCCGACGCCGATGAGGGCGCCAATGCGTGGGGGATGTCTGAGGACTTCAAAGCGCAGCCGTAATTTAGATGTAAGCTTAGTTC
TGTCTGTCATCAGGACCAAGCCTATAGAAATTCGCAAATAATGCACAAAGTCCTGCATTCTGACCCATATAAAAAGCTTCAACCGCCAAAGACGCTGGTG
CACTGCACAACACACATTCGACACCATGGGGCACACGGCTAGCGTCAATCGGCAGCGCCGCAGCTCGACAGGGACGCTGTATGGAGAGCCGGCGGGTGCG
ACTGCGGCCCCGCGCGGGAGCTACACGCCGGCGCAGATGCAGGCGCTGTATCTGAGCCGAGGGCGGCCGGACATGGCCTTCATGTCCAATCAGGGGCGTC
TCCCCGTTGAGGTGCCAGAGCTGCAGCAGACGTGCACTGTCAAGAACCACGTGAACCTCAAGAAGGCCAGCCTCAAGCTGCAGCAGTCGCCCACCGACCC
AAATCACTACGCGCTGGAGTTCCAGTTCGATGCCACCAAGCCCTGTCGCATCAGTGTCTTCTTGGTGGCAACGGAGACCATCAACGCGGACACTGGCAGC
TCCAGCTTTGCCTTGGTTCACGCCGACAAGAACCCCGTGCTGGCCCAGCACTTCCCTTCAGGCTTGGGCCAGATCTTCGTGCTGAAGGAAGGAGAGACAG
AAGACGATGCGTCCAAGGAAGAGGAACACGAGAAGCACGAGCAGCCTTTGCCTCTCTTGAACTTCTCGATGTACGACCCTGACGAGCTGGTGTACAAACC
CGGCGCAGTGCAGTTCCCATTGATCGTTGTGCTGGAAGTGTCATCGGACAGTGAGTGCGCGTGGAATTGATGCACTCGTTGTTGCTGGATCTCAATTCTA
ACCCGTGCATTGCTTGATATCTAGGGAAACGCCCTCAGTCCCAGTCAACATTCTGCACGTTTGTCAAGAAAGGGGAGAACACTTGGGACGTCAAGATGCT
CAAGCAAAAGATTCTGGTACGAGCATAGACAACTTTTTATGGGTTTTGTTATGTTTGAAGCGCTGACCGCGGTTTGTTGCGTGTAGGTGGATGGATTGAC
ATACGAGTTGCAGGAGATTTACGGCATCGATGGTATGGTGGCTGCAGCACCAAAGACTGAACGCACTGGCGCAGCAGGCGAAGGCACCATCGACGCAGCT
CAGGCACCCAAGGATGAAATTGAGATTCCCGAAGGCGCAGAGTGTATCATTTGCTTGTGTGAGCCGCGGAACACGACCATTTTGCCGTGCCGGCACATGT
GTCTCTGCAGTGAGTGTGCTGAGGCGCTGCGTAAGAGTTCAAGCACGTGCCCAATCTGCCGGACGCGTGTCGAAGCACTGCTGCAGATTCGCGTGGAGGC
GAAGGAGACTACGACCACGGAATCTGAGGAAGATACTAAGGCCGAAGTAGACGAAAACAAGTGAGCGTGCGTACTAAAGCAAAGCAGGTCATTTATGAAT
ACAATAGTTTCGAGAACAATTGGAACTGAACCACGCTAAGCTTTGACCACGTGTGATGAAATTCATTCTGGTAGACGGAACAGGCAGTCGCTCGAAGATA
ACGAAAGAATTTATCAAGTCTTACTGTTTTCCTTCCTACCTCATCCTTGTCGTTTCGAAGCGTGCTGAACCACCGGAACCAGAAGTTACCCACGGCTTCT
GTCCGGTTGGATCTTCACACTCAGGTCGGACTCTCTATCTTTTGCAAATCTCGTCGTCGTGGATGGCATCACGGCAGTGCAGCTGGATTTCACGCCTTGA
TTTTTGTTTGTTTTGGCTGAATATCTTGTACAAATAGTGGTGGCGCGTGGCGGTGCGTGCTTGGCGGTGAAAAGACTCGACAAAGGCGTTTGATTAGCTT
GTCGCTAACTGTGTGCCTTCATTGTCGATTAGTTACACCAAAACACATGCAGATAATACGTTACTGTCGCACCGCATCCCCTCCGCTGCTCACACTTGTG
CTCGTGCTCCATCTTGCAGACTAGATTAACTGATGCCGCTTCGAACCCCCGTGGCGAAGGGGCTGCCCGTAGTCAGCTAGTTGTTCTTTCTCCACATTCC
CTTCATCTACGATTCAGAAATGAAAGTCAGTAAAATGGACTCAACCGCGGCGAGGACTTACCACGATGCACACCTTTTGACTTACCAGGTTGGCGACTTG
CTCGGGGGCGTCACGCAGACGGTTTCCCGATGTCGACGGAGTCGAGCTGACATCACCCGTTGGGCCGTAGTAAGGGCTGCTCTGGCCTTTGGCAGGGTAG
CCACCGCGCGTAGATCTTGGTGCCTCCTCCACCTTGGCGTTGAGGTCTCCTGACGATTGGGACTGGAAATCTGCTAGCGTTGGCTGACGACCGTTACGAC
TCGAAGGAGGGGGGCTGCCACCGCTTCCAGCGCTGTTATTGTCTCCTCGCCGTTTGGGACTCTGAGATCCGCCATGGCTAAAGTTGTTGTCTGCGCTGGA
GTTGGAATCATCTGAAGTTGTAGGAGATCCGACCTTGGCAGGATTGTAGGAAAGCTTGCGAGTCATCATCTCCACCATTTGTTCCCGCTTCTTCAGCTCG
CTTTCGCGGCGCATGTAGTCCACCTCCAGCTCTGTACGCAAAAAATCATTAGCAGTTGGTCATGATTAAAAATATGCACGAGTTCGTACCTTTCAGCTTC
TTCTCACGAGCCATCAGAGCAGCTTCCTGGCGACGGAGATCTTCCTCGATGCCTAACAGCTCCTTCATCTTCTGGTTGTAAGACGTCTGCAAGTTCTGAT
CAGCAGCGGGCTGCGGGGCGTTCGCCGCAGCGTACGCACGTAATCTCTGCTGCAGCTGTGGGACGCGCTCCAGGTCCTCGATTCTCGGTCGTCGCGAGCG
TTGCCTGTGCAGCATCCACCGGATAACCTGGAAGAGACCCTCGGAGTACTGCGACGGAATGCGCGTGAACTTGCCAGCGTTAATCTTCTTCGCCAGTGCC
AACTGATTTGTCGCATCGAACGGGGGGCCTAGCGTGGCCATCTCGTACAGCAGACATCCCAGAGCCCAAATGTCTGAACGGTCGTCGTAGGTCATCTCAT
TCACCATTTCGGGACTCATGTAGTAGGGCGTGCCGACGTTTGTCTGCGCGAAGCGAGACTCGCTGCTGAGCTCCTTGGCGAGACCAAAGTCACCGAGCTT
GGCGTTGTTCTGTGCATTAGTAAAAAGGGAGTGAGACACAGTGTAGACAACAAAAAATCCTGCATTGCAGTCGTACGTTGGAGTCTAGGAAAATGTTGCC
GGGCTTGATGTCACGGTGAAGAATGGGCCGGATGGCGTTGCCTTCGCGGTGACGGTGGCACTCCTTCAGCGCCAAGAAAATGTGCGTGAAAATGTGCCAG
ATGAAGCCCTCCTCGATGTAGGAGCTACAGTGACAAAGGCATCAAGTCAGATTTCACACACTGAACCATGATGCAAGATGCTGCTCTTGAGATAGACATC
CGGACGTGACGTGCCAACGTACCCTTCACGCTTTTTCCTCTTAATGAACTGACCCAGATCACCGCCCTCGCAGTACTCCATGACGATGTAAATCTTGGTG
GCCTGCTTGTCGATCACTCGGTCCAGGTAGCGCACAATGTGCGGGTGACGCAGCTCACGAAGAATGTTCACCTGCAGCACCCAACCCACAGAATTATCAG
TTTACGTCCCAAAAAGAGTCTGCTCCACCTGTAGACGAAGCACGACGCACCTCGCTGACGATGAGCTGCTTCTCCTTCTCGCTCATGGCGCCGTAGTTGA
CTTCCTTCCACACCAGCATCTGCGACGCACACACACATATCAGTACGCCGCCCCCACCGAACGGTTGGAAGTCGTATTTGCCTGTCGCAGCTCACCTTGC
GGTCGGACTTGCGCACGATCTGCGTGACGACGCCGAAGGAGCCCTTGCCGATGATGCGGACCTGCTCGTAGGCGTCCATGGCGGCTGGCTAGCTGCGGCT
GTGGCTGTGGAGGGGAGTTAGGTCTTCTCCGCGCAGGGAGGAGGGGGCAATGGCCGTGCCTTCGGGTAACGCGAGGGACCGGAGAGAGCGCGACGGAAGG
AGCGACACTGACGACGCCCGCCAACTCGTCTTCTCCTCTCGCTGTTCTTCGGTTTGTGGGCTTTTATCTGCGCGGCAAACGCCAGCCAACTCTCCCCCCC
TTTGTTACTCCCCGGTAGCCAACTATTAATTCCCCTTTTCCACGTAGCATACTGAAACCCAGTCACGATTCTAAGCGAGGAAGGACGAGATGTGGTAAAT
CACCGAGAGGTCGCATGCCTAGAAAAAAATGTCAGCGGGTAGACGTCTTCCATGCATTCGAAACAGGGCGCCCAGTACCTCAATGTAGTGCATGTTGGCT
CCCCAAATGCCGAGTTGCTGGGGGGGATTGCACGCCGAGATGGCGCGTTACCAATGATCCGGCGTTTCCTGTCGTTTCAGACGGTCTGTTTACAACGCCA
CACCGCCACGGTACTGCCGCCGTGACCGTTCGCGTGACTTCCCGGATTCATTGGCTCACCGGTATAGGCAAGTCAGTTCAAAAAGCCAGCCGCGCCACGG
CCATCGTTGCCGTGCAAAGCCAACACAAGAGGCGGAAGAGAAAGTCGGGATCGCTGCTCGTTCGTCTGCCCGACAGATAACCCGAAATGCGCGGCGCGGA
TCGCGTCTCGCCTCGAGCTCTGAGCGCGGACACATATGCTGCGGCTGCAACGCGTCGACCCTGGTTTCCAGTACATCATCATCGGGCTCC