Description :
From Genome Similarity Track
Location :
Scaffold_15:30894- 32393
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_15-fgenesh-gene-0.17GTP-binding protein

Sequence
1499 bases(100 bases per row)
CTGCGGACCTCCTCCTGATGCTCCTGTCGCGGCCTCCTCTTGCGCCTCCTTCGTGAACTTGAATGCGGTGCGCGTCGGTGGAGGAGACGGCGGTCGAAAC
ACCCGGGACTGTGTGCCGGCACTGGGCGTGTGAGGCCGAGAGATGTTGGGCAGTGACGTCTGGCGGGACATCGCCCCTGAGCTCGACTTTGGGCGTCCCG
AGATCGACTTCGTCGGCGAAGGAGACCGGGACGACGTCTTCCCAATCACCTGCTCGATGGTCTTGGACGCCTGGTTCCACTTCTTCGTGATCTTGACAGT
CTCCATTGTCCGCATGATCAGGTCGCGCTGGATCTTCGCGTGCACCGCGATCTGCTTGCGTCGCTTCACCAGGTCGTCCTTCTCGCTCAGCATCGCCTGT
GTGCGCTGCTCGGTCTCCTGCAGCTTGCGCAGCGTCTCGAGGCGCTTGTACTCCTGGATGCGCTTCATGCGCTCCACTTTGTCAAGCTTGAGTTGCTGCT
GGATGCGGCGGTACTCCTTCTTGAGCTCCAGTTGCTGCTGCTGAGTCTCCTGCAGCTGGTGGACGTTCCTGTCCATCTCGTGTTGACGCTGCAGAAGCTC
CTCTTTCTTGCGCTCGTCTTCGCGCTTCGCCTCTTCGATGACCATGAGTCGCTTCCGCTCCATCATCTCCTGCTGCTGCCGTGCCAGTTCTCGTTGGCGC
TCCATCTCGGCTTCGTGCTCCTGGCGGAGCTGCTCGCTCGCCTTCTGCTTCCGCTTGATGACCCGTTTCCGCTGCAGCTCGAGCTTCTTGGACTGTTTGA
GGTTCTTGCGGATGCGCTGCGTCACCACGCGCCGGCGGTCTTCCATCTGTCTCGCGCGTTCGNNNNNNNNNNNNNNNNNNNNNNCGCTGCTGCTCAACCA
TCTCGTTGCGCGCGCGCTCGGCGAGATCGAGCTCCTTGAGCCGCTCGCTGATCTCCAGCTGCTGTTGCCGCATGATCTCCTCGGTTATCAGCCGGTGTTC
CTCCGCCTTCGCCTTGCGCTCTTCCTCCCGCTCGCGCGCCTCGATGCGCCGTAAGCGCTCCTGTTTAGCCTTTTGCTCGGCTAGCTCGCGGTCGCGCTGT
GCCACCTCGGCCGCGATGAACTTTCGGCGCTCTTCCTCGGCGTCCAGCTGCGCTTTCTTCTTGATCTCGCGCTGCCGCTTCTCCTCCGCCATCTCCTGTG
CGAACCGCATGCGCTCCCGCTCGCGCTGCTCGTAGAGCCGTCGTTCGCGCTCGACCTTCTCGCTGGCCTCCTGCTGGATCTTGCCCATCTTGATCTCAAA
GGCGAGCATCTGCTCCAGCTCGCGCTCCTGCCGGAGCTTGACCTTCTCGAGCCGCTTTTTCTCGATCTCGATGAACGCGAGCTTCGAGTCGGACTTCTCA
GGGATGGTGCGCATCGACGCCGCCTGTGCTGCCTTGTTGCTGCTGCTGCTGCTGTGCTTCTTGCTGTGATTGCGGTGGCTGTGAGTTGCTCCTGGCGGC