Description :
From Genome Similarity Track
Location :
Scaffold_144:30881- 38027
Transcript NameFunction/comments
Phymu_g5420hypothetical protein
Phymu_g5421hypothetical protein PHYSODRAFT_471024
Phymu_g5422hypothetical protein PHYSODRAFT_284634
Phymu_g5423hypothetical protein

Sequence
7146 bases(100 bases per row)
GATCTACAGCGTTAACATCAGTTCCATCGCTCTCTGCTTCCCAGATTCCTTGCACCGACCACCCCAACGTGCTGGTCATTGTATGCCATAACTCGTCTCG
GAAGGTCGACGCATTTGTGATGTGTTTTCCTGTCTTGACTTCGGTAAAAAGCAGCTCGTATCCTCCCGACGTGCTCTGCAAATAGTTCCCATCCAGTGAG
AAGTCCATATGAGTGATATAACTCGAGTGCTTGTTGAATACATGAGTCCGTGAAAACCCCTTCAAAACGTTGTATATGTAGATTTTGGAGTCGTGGCTGG
CTACAGCCAACGTTCGGTTATCTGGTGAGAACTTCACATCGCTAACCCACCTCTTCGCATCAAAACAGGGTTCTTTCACACAAGTCAAATCAACAGCACT
GTACACCACGAAACCTCCATTGGGCTGTCGTTTCTTCGAGTTGACTACTGCCTTTGCTTTTCCAGAGTCCTCACTGCCAAGACCAACCGTGATTAATTTG
CCATCACTTGAGTATGCGCAAGAACGTCCTGGTATTGGTAGCTCTAGGAATCCAAGCTCATAGTGCGCTGCTAAATCCCAGATGCGGAGGGTCTGATCGT
CCCCGACCGTACAACACTGTTGCTTTGTGGGGTGAACATCTAACCCCCATAATTCTCCTTGAAAATGCCCTTTAGTAAGAGGCTCCGAGTGAATATTCTG
TCCTGACTTCGTATCCACTTCATAAATCTCCGACGCAAGTGTGCCAACGAGAATGGTCCGTCTATCTGGAGAAtaacagcagcttcgtatGCCCTTGCGC
TGAGAAAGTGAGGAGGATTCAAAAGAATCCTGGATCTGGATTGGAGTGCCAACTTGTTTCAACTTTTCATCCCACTGAATGATTTGGCCATCCCGGCCTC
CCGACAGCAACAAACCTGCAGAATAAGATAAAGCAGTGATGGCTCCTTCGTGCGCCTTCACGACGTTTGTCAGCTGTCTACCCACAAAAAGATACAAGGA
ACCATCGCTGGTTCCCACAACGACGGCCTGGTCTGCTGATTCGAGGTATTGGGCCACGGGAAATGGCTGGAGCGATCCTTTTTTCCCTAACAAACCCTTC
TTCGGTACAAGCTCCTTCCCCTCGAGGGACCAAAACTCAACGTACTTTTGACCGCATGTGACAAACTCATTTGGGACGCGAGGATTCGTTGTGATGTGAT
ATGGGGCTGCTTTGTTGCCTTTTACTGACATTTTCAGTACTGCAGATTTCCAGTTATTGCTCGACTCGTAAACTGCAATACTGTGATCGTCATCTGCTCC
TATCGataccagcagctcggggCTCAGGAAAGCTAATTGTAAGATTCCACGCTTGTGAAAACCTTGCAGGATACACTGCACCTCCATTGAGTCCAGATCC
CACACAACAATTTTGGGCTGCTTGCCGATTTCACCGCTTGCAGCCAGGGGGAGACGTGGGTGTAGGCACAAGCTCAGAACATCGTCTGTGTGGGTGagtt
ggtggcgctgcttcatTCCCTTTGTGTTTAAAACaacacaagcagcagcagctggatATACGATCTCTTCGATACGCCCAGCCTTAGCATTGGCCGTAGT
TGTTACGAAGCGTACATTGTTCTTGCAATCTTGTGCGCTGTAGCCAAAGATCCAGTCCAGCTTGACTGAAACCAACGGGGCTCCTTTAGATAGAGCAGGG
ATTTTGCTTGGAGGCACAATCGCTCCAATCCAGGGCTTCACAGCTAGAAACATGTCACCAACGTCATCCGGTGCAACGTCCATCAGGGTATTGACTACTG
TCGAAGAGTCTGCGAGATCCGAGTGCTTTTCAAGCTTAGCCACCAGATCCATGCTTTCCGCCAAAGGTGTCCCTTCCTCGGAGGGATGAAGTTCGTGTTG
TTCAGAGTTGGAGCCTGCCACATCGAACAGTTCAAAGAGCTCTTTTGCGCGCTTGTTCTTCAAGCTGAACTCCCGAAATTGTTCGCATGTGATTGTAGTC
GAGTCCGCTTCGGATCCTTTATCCTTTGACAATGAAACTCCGCAATTAGCTATCTCCCGAAACATAGACTCAGCAAGCATAATAATTTCCTCCTCATCGA
CAGTTGTGTCCAGGCTCATTGCCTTGCTGCTTGAATTCGGTTGAAGAATCTTCGCTAGTCCCGACATTGTCGACTTCAAGGAAATCGTGAACTCATCCAA
ATCCAAAGCTCCATCCTCGGACATATCCCAAGAGTCAAATAGCAAATCAACCTTTTCATCCAATGGTATAGCAGCAACGAACGCAATAGCTGATAGAAAC
TCGAGCGCGTCGATCACTGCCAAGCTGTCGCTCGGGCTCTGGTACTGCTGGCTCTGTAATCCTCGAGAGCCTagctgcgtttgctgccaTCGTTTCTGCA
TCAGCGGGTCAGCAAACAACTCAAAGGCAGCGTCAGCATACTCTGCAACTCTAGAATGAGAGCTTTGCAGACTAGAAACACCCAAGGCGACTGCGCGACA
GCAAATAGATCGAAATTGTCCCTTGGACAGCGCAAAGCTCGTCGCCGAGTCGTAGAACGCGCGCCAGAACGTCTCGATTTCGTGTAGCTGCAAGTTGTCG
AAGGGAAGGATAGCGTCAGCCAGCGCCACAGCCTGCCGGTCCTTCACAGCCGCCAGCAGGAACGCATTGCCCATGTTGCTTTGATACACACACTCCTGCA
CCCTttcgtgctcttcaactTTTCCACCAATAGGAATGGTCTTGATATTGTGTGCAAGTGGTGTGGCAATAAGCGCACAAGAGAGCGAGGGAAGAATCCG
CGCCACTCAAATACCGATTGGACTCATATACGTAGCGAATATGGCAGACATCCAGAACTTCCAGACCTTCGGTGCGTCCCTATAGCCACAGCAAAGCGAC
ACTGTATGCGCAATGCTGCCAGATAGGTGCTGAGCGATATTCTGACGTATATTTCTCGCCCCACAGACGCTTTTGCggacgccaaggacgacTCGAGCAT
CGGCGGAGGCAAGGTCCACGtgcgtgtgcagcagcgtaACGGCCGCAAGTGTCTGACGACTGTGCAAGGCCTGGCCGATGACCTGGACGTAAAGCGTATC
CTCAAGGCtttcaagaagaacttcaGCTGCAACGGCGCCATCGTgaaggacgacgagctgggcgagaTCATTCAGCTGTCGGGTGACCAGCGAACGAACA
TCCGTGAGTTCCTGCTGGACCAGGAGATCTGCACGGACGCCCAGGTGGTGCTGCACGGTTTCTAAGACGGCAGGGCCCCAGGTGCTGTAACTTTTAGTTG
CCGCggtctgcagcttcttgacgtctGCAGGCTTGTGGTTTAAAACAGTTAGATGAGAAgggaggaaggagacgagaTGGCGGGCGTCTCTTCCTGTCTC
TCGGCGGCTGCTGAAAGAATATATTTGATGCTTCACTTGTTGAGGAGAGCCACCTCCACAATGTAATTACAGTCGTCATACCTACCGCCATCACACGGTG
TATACAAGTGTGATTCACCCCTGCATAAAGTGCTGCAATCTACACTTGACGACACAGGAACGACGAAGCTTGAGCACCTGAAGTTGCCTCTCCCCTAACG
GCAGTAGCTGCATCGACGTCTACGTGCGGTCACTGATTTTGAACTCCGGGAAGTCTAGGTCCGGCTGCCAGATGCCCTGAATGGTAGGACGCTTCGAGTA
GACCGGCTTCTTGATAGGCGTCATCTTACGGCCACTAGAGTTACGAAggcgctccagctgcacaATCACGTCACAAACAAGTTTGTATGCAGCATCCATC
GTCAGCACAACAATCGTTAAACAAAACATTTATCTAATTGTTTCGCACCTGCTTCAGGATGAAGGGGATGTCCTGGTTCTTGATGTCAGCCACCTTACGC
TGGTTTGTCACTGCAATAAACCGCAAAGTCTTTTTTAGCAAATTGAGCTCCAACATCTCATGTGCAGGACGCATATACCGTAGTCTCCGATCAGGATGGG
GTGGCGAGCGCCCTTGAGCTCCGTGTCGAACTGCACCTGTGggttctcctccacgaacttgaGGAAGCGCTCGTCGCTCATAAGCTGCCGCACATAGCGA
CTGCTGCCGCCGTGCTGGCAGTAACGGATCGTCacctgcttgagctgccaCACACCCTTCGTCGCCATGCTGTCCCTGGTCTATTGAGCGTGCGGTCGGA
GTGAAGGCTTGAATTGTTTGGCTTAGGGGATAGctgtgtgcaccacaccaaTATTTCCAAGTTGAACCCATACGTACTTAAGTGcgagcaactgcagcat
tgaACAGCGTTACAGAGTGAATGCGCCGATGGCTGAGCGCTCAGGACCCGACGAGGCTGAGAAGAGCGATGTGGACAGCTTGCTACGGATCGTGCACAcc
caccagcgccaacatGACGACCGTGAATACGATTCGAGTGCTCCTGCCGCCATCAGACGCTGCAAAACGATGCTGACCAAGCTACGCAAACTTCTTCCCA
AGCTCATGCGTCCTGTGGCGACTCTGGCGACCGACAAGGCGGTTCCTGTGCTGCAGGATTTGTGCCAGCTCCTTGCACTGCTTCTGGGTGGCGGAGCGTG
TCCACATTCGATGACGCTTTTCATGGAGAATGACACCGGTGTGGTGCACGGGAACAACCCGGTTGCCTCGGGGTTTCCGTCCTACCCGACGATGGCCACA
ATGCTGTTTTACATGGTATCTTTCTACACGAACGAGGCACTGAGAGAAGCACAGAGAGACGTTCGTGGCGTAACGTTGCAGATGGTTTTGTTTCTGCAGA
AGAACGACGTGTATGGCTTTATTCACTTCTTCCGTGATACTGTGCAGCTACTGGAGGACTGCTTCTTACTGGAGGAGTCTTTGAAGGACAGAGATTCGAT
GGATGTTTTACCTGGTGGAGCTAATATCGCGTGCTATCTGGACACTGGGATTCACGTGTACCAGGATGCGGATGGACCACTTGGAGCGAAAAGCAATGTT
GCGTTGTGTGGGTGTATCCCAATTACAGATCTGAAACAGCTTTACGAACGCAGagagaagctgaagcggatgCTGCCATCTATTTCTGTTGGCTCGTATA
GagcggtggtggtgcttcgGCAATCTGTGGTCATTCTTGCCGAGTCGATCATTCGTGAGCATAACGTGATACTCGAAGGAGATCAGTCTTTAGACAGGCT
ATGCCAACTTGTGGGACTTTTTGTCGTTAAAAACGAGGAGCTCGTAAAATGCGCCGATGGAGCGTATGTGAATGGCGCTGTTTCAAGCCTTGACGCGAGT
GGAATTACTAGAAGCACACTTCGATTGCTACACACGTTGCTGCAGGCCAGCGTCTCTACAGAAAGACGATTTGTTCGCTTGGTACTGGTGTTTTTAAAGG
CCAGAGATCTTCACGAAGCTAATCCACGAATACTGAAAGCCTGCGCAGCCATCCTCGAGTTAATCGGCGAACTTTTCCCCCGACTCTCTAAGTTTGCTAC
TGATGCCCTGTGGCCTTCTTTTGAGTTGTGGATATCTGCGAACATGGACCTCGGTCGCGGGGCTAGTCGTGAAAGCAAAGGCAGCGTGGAGATAATTTGG
ATATCTGTGCTTTCGATTCTGGGCTCGTACACTTGCCAGTCCAACACTTCATCCCCCGCTTCGTTATATATGGATTTGTTGGGGCACTTTGATCTAAAAG
ACTCGAATCCTGCAGTGGTGTCACGGATAATTGCTGGCATTCACCGTATGCTGTCAGCAAAGGACATGCTGACAAAGGTGATTCGTTATATATCAAAGGA
GTTGGTTAACAATGGAAATAATGCGGTGAGCTCATGTCAATACCCCCGGGCAAGGAAGCGAAAGCGAAGTGATTTATCTGTGGGCACAGAGAATCCATCT
CTACAGTTGCGTCGAGAGAACGACATTCAGTTATACGAAAAGCTGGGTCGGTGGATACTTAACCTCATTTCCATCGGGAATGGTAGCGACCGGAAGAGTA
TAGTGGGGATTTCCACCATTTTGCGGGTGATCTTGCCTCTTCGTCGCTACATTGTTTCCTTTGTTCGGCTAGAAAGCTTTGCCGTATTCCGATCACTTCT
GCAGCGCGTTGATTTGATTGTGAACACTAACGCACCATCGCTCGCCTCCCTCACAAGTGAATACATTGATCTATGGATAATCTTGCTGCGGTATTTCGAC
GATCACGAGCTTGAGAAGTATCATAACTTGCTGACCAAAGTTGTGGAGAGTGTAGAGACTCAGGGGCTCTTTGCGCGCAGTGTTGGACGGGATAAGTCTT
TTACAGTACCAGAATGTTGGGAGTATCTGGAATTGTTAGAACTGTACCAACGCCACTCCAAGTGCCACGACTTGGCTCCACTGGAAAGACCCGATGACGT
ATCATACGATTACCTTCGAAGCGCAGACTCCTTTCTTGATGTTATTTTCCGAAAATCTGTGGCGCTCCGCGGTCCATTCTTGATATACTTTGTGTGGTCC
CGTCCTGTGGCTCTGAACATTACCGATGAAGATTCATGGCGGAATGCGTTACCATGGAAGGTTACGTACCGAGCGATTTTGCAAGAAACGTCACTCGACG
TGGCAGTGTGTACTTATCTTGCTATGACACCCCTTCTTGCTTTCTTTGTCGTGTTCGGATCATTAACGTCCCCGAAAAAGATGACTACTTGCATCATGGA
AGCTTTTAGTGGAAAGATTCAACGGACAGCGTCGGAAACGATTTCGTGGGCAATAACACAAGCATGCGGGGCTGTGCTTTGCGCAGCAGCCTTTGGTCAA
ACGTGCGCCAAAGGAGAAAATAATTCCAGCACCATACAAGACCCCCCTATGTATTGCCGTATGAAGAGTTGTCAATGCCGAAAGATATCTACTGGCCGTC
AAGCGATGCCAATTCCACTTGCGTTGTTCGAGCCGATAATCTGCGACGAAACAGGTGCCGCCGTCGAAAATATGCAAGTGGTCAAAATCAATGCGCTGTC
GAGTGTGTTTGAGCACTGTGAGGTTGATTATGGAAAGGACGAGACTGCTATGAAATTTGTGGAACGCCTTCTAACGTGCTTCGGCCATCGTTCGGAGCTC
GTCCGACAAGCGGTCCTGGAATCGGTTTACCACCAACCCCGCCTTC