Description :
From Genome Similarity Track
Location :
Scaffold_927:3088- 4877
Transcript NameFunction/comments
Phyag_g8737hypothetical protein PHYSODRAFT_508709

Sequence
1789 bases(100 bases per row)
GCGTGAACAACCAAGACCTCGACATCCCCAAACGATTGTCGTTTGTGAGTGGCACCTCCCAAGCGAAAGACCTCGAAGACGGAAGCTACGTCGGCATCAA
GTCACCCGATCCAGCTCCCATCGGCGCACGCCccactggtgcagcagatggCGCCATCCGTGAAGGAGGCATGCCCGTCCTGACCAGCAAGGAGAACCTC
GGTCTGCTCTTTGAGTACGCCGCTGTCGGTCTGGTCTACGGTCTGCTACCCGAGACCATCTACCCGTTCATGCAAGAGTACTTGAACTGTTCGGGTTCCC
AAGTGACGGCCGCCACtcagctcgtcgtgcttcCGTGGAGCTTCAAGGTCTTCTACGGCATTCTGTCGGATTGCCGACCTATCTGCGGCTATCGTCGCCG
GCCGTACATGCTCATCGGTTGGGGGATCTGCTTCATTATGCTGCTCGTCATGTGCATCATGCCTATCGGCAAGCCGTACTTCACCGACGCCGCGGATCGA
GATGTTGATATCGCCGACTACACGCCAGAGATCGAAGCCCGCATCAACTACAATGCACCTTCGGAAGGAGCCAAGTACGTCATGCTTATGTTCTTCGCGG
CGGTCGGTTATGTCATGTCGGACGTGTGCGCCGACAGTATCACCGTGGAATTGGCGCAACGCGAGCCTCTTGACAAACGTGGCAAGACGCAGTCGTGCAT
CTACACGGTGCGTACTGTTATGGTGATCGTCGGCGAGCTGTTGaccggtttcttcttcaacggcGAAGACTACGgcggcgacttcaacttctctCTTAGC
TTCCCCCAGTTGATGATCATCGTGACGGTGCTTACGATCCCGGTCTTCCCGATGACCTGGTTCTtcatcaaggaggagaaagtgGAGCCGGCCAACTTCA
AGGAGTATATCACCAGCTTCTGGGATCTATTGTGCACTCGCGCAGTGTACCAAGTCATCGCGTAcaacttcttcgccaacatTTTCGCCGACATCACGTA
CACAGGCAGCACTCCCGTCGCGGACTACATGGTGGGCGTCACGCCGATCAACAGCACTTTGAGCGATATCTTGAGTAACCTGCTGTTCATGTTCGGCATC
ATGATCACGTCCAAATGGGGTCTGCACTGGAACTGGCGATGGATGATCGTCGTTACCGGAGCAGTGGTGatcgtcgtcgactgcgcCGTATCCATGATCG
TGGTTTGGGACATCTTCCGTAACCAGTGGTTTTGGCTTGGCCCTCCTATCGCCGTGCAGCTCCCGTACGGTGTCGGCTGGATCATCTCAACTTTCGTGAC
GGTTGAATTGGCGGGACTCGGcaatgaagctgctgtctaCGGTCTGATCACGACGGTGACCAACGTCGCGGCGCCCTTCGCTTCAGCGTTGACCCTCGTG
ATTGACGCCCCGTTCAACATCACCAACGCGCGAGTGCAGGAGGACGACCACTCCATTCGCATGGACCTCACCTACACGATCATCATTATGTATGCTATGA
CGGCTTTCGCCTGGgtgttcctgttcctgctgccgaAGCAGAAGGAAGACACacagcgactgctgcgtgaagGTGGCAAGAGCAAACTCATTGGTGGAAT
CACGGTGTTCTACCTGTGCTTTGCGATCGTGTGGTCGATTATGACCAACATTATGgccatcttcaccagcacTTCGTGTCTTGTCATTGCAGGCGGTTCT
GGCTGCTAATTTTCTACATGTACTACTTGATTGAGTTTGTGTTTAAGCTTGGCACCCTGAGGTATCAATACATGTACGGGAAAATCTAA