Description :
From Genome Similarity Track
Location :
Scaffold_85:30877- 32243
Sequence
1366 bases(100 bases per row)
TGCCGGCAAATAATCAGAATGTGTTGTCACATAGACTTGAGTTCCATACAAAACCGCGGGCGGCGCATAAAGTACTTTTGCTGTCTACTTTTCAGCTCGG
CGTGCTATTTGACGTGTCCGTGCATATATTGCGAGGGCGTTAATGAGTGTATTTGCCACGCGCTCGTGATACCCAAGCTATGCATGAAAAACCCTGTTTC
CTTATCGGGACGTTTGCGTCGTCGTGCTAGCTTTCTGTGCTTACGCTATTGATGTATCAGTCTGTTTAATCAAGCGTGTCACTAAGTGGGCACAGACCAT
TCCACAGCGATACAGGTATGCTGAACGCGCGTCTGTTAGCAGTAGCCAACGCGATATATACGCGCGAGGCGGGCACACCTTATAGTCATCCGCGACTCAA
CCGAGCTCTTATCTCGGTCATTATGGACAGGACACTAAAGTACAATATTGCGTTCACACATCGACTTGCCACGTCCATCTGTACGGTCTGCACTTTCACG
CAGTGGTAGTATCTATGTAAACAGCAGCTTATTCGTCGCACGTAGTTCCGACTGTGGTTTAAATTGTGAGCGCCAATTAGTGCAATATACGCTATAAGAG
CTGATGGTACAGATAAAATGTTTTTGCGTGTGCCCCCGTGAGCGAGTGTACGTGCCATCTACGGTGACGCGCATGCAGATAGAAACGGCCAGCTTGCAGA
GGTACACAGTACATACCTCGTGCTAGTTATTATATGAAGCGCGCTACGCTCTATAGGTGCGTCAACACGCTTGGTAGCGCCACAGTCAGCTTACAGTATG
TGCGACCCCAAGCCTTGCACCGTCAGCCAGTATACAAAACTATGCGGGGTAAGGGGCTATAAGGATGTATATCCAAATCACCTGCTCTTCTGCTGCTTCT
TTTGCTCAATGTACCTGACGTTTCAGACGGCCAGCTTGCGAGGGCGGCTGTGTCTATTTTTCCTCTTGAGGTACCAGTCAGAGCCCATCACCTTCTCGAC
GTTTGGCAGGCTTTCCTGGCGGCGCACTTCAGCCGAATCAGGTGGTGGAAGCTTTTCCTCCCAGACGTTAACCGCTTTTGGGCCGTTCTTGCCGGCAATA
CAGGGCCGCACGCTGCCCCGTCCGCTGATTGTACGGAACGCGTAGCCGTACTGCAGCTTCCCGCAACCGACGCAGCGCGCCCGGGCATCCGTCATAGACC
GCTGCGGGTTTAGCAGAAGCGGGTCAATCTTCGCCTCGCATTGCTTGCACGTATGTCCCACCATTTTGCAAACTGTGAGTATGTTAGCAACATATATTGT
TTTAACCCATTACTTGCGTCCAAATTTTAGCCGATAGCACGGTACTCTAAGGCTAGTATTTATTTT